EMAIL THIS PAGE TO A FRIEND

NDRG2

NDRG family member 2

Synonyms: SYLD
Gene ID:
Human(57447) Summary: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Mouse(29811) N-myc downstream regulated gene 2
Rat(171114) NDRG family member 2
Zebrafish(494050) N-myc downstream regulated gene 2
dog(609390) NDRG family member 2
cow(515063) NDRG family member 2
domestic cat(101083181) NDRG family member 2
naked mole-rat(101721691) NDRG family member 2
Domestic Rabbit(100351595) NDRG family member 2
domestic guinea pig(100715534) NDRG family member 2
sheep(101110763) NDRG family member 2
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501708 Anti-NDRG2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, canine, rat
ELISA, western blot pricing
SAB1409568 Anti-NDRG2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
HPA002896 Anti-NDRG2 antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV47976 Anti-NDRG2 antibody produced in rabbit affinity isolated antibody mouse, canine, pig, guinea pig, human, bovine, rat, horse, rabbit
western blot pricing
HPA003590 Anti-NDRG2 antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106795 Anti-NDRG2 antibody produced in rabbit affinity isolated antibody mouse, rabbit, guinea pig, horse, human
ELISA, western blot pricing
SAB1411146 Anti-NDRG2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0057447M3 Monoclonal Anti-NDRG2 antibody produced in mouse clone 6A5, purified immunoglobulin, buffered aqueous solution mouse
ELISA, western blot pricing
SAB1409567 Monoclonal Anti-NDRG2 antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1405208 Monoclonal Anti-NDRG2, (N-terminal) antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU066241 MISSION® esiRNA esiRNA human NDRG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016250 Rosetta Predictions human pricing
NM_201535 Rosetta Predictions human pricing
NM_201536 Rosetta Predictions human pricing
NM_201537 Rosetta Predictions human pricing
NM_201538 Rosetta Predictions human pricing
NM_201539 Rosetta Predictions human pricing
NM_201540 Rosetta Predictions human pricing
NM_201541 Rosetta Predictions human pricing
NM_133583 Rosetta Predictions rat pricing
NM_013864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349132 predicted 452
2 SASI_Hs01_00187316 predicted 747
3 SASI_Hs01_00187317 predicted 521
4 SASI_Hs01_00187318 predicted 1554
5 SASI_Hs01_00187319 predicted 708
6 SASI_Hs01_00187321 predicted 568
7 SASI_Hs01_00187322 predicted 1729
8 SASI_Hs01_00187323 predicted 1431
9 SASI_Hs01_00187324 predicted 1365
10 SASI_Hs01_00187325 predicted 586
11 SASI_Hs01_00187320 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373014 predicted 493
2 SASI_Hs01_00067624 predicted 792
3 SASI_Hs01_00067625 predicted 563
4 SASI_Hs01_00067626 predicted 1595
5 SASI_Hs01_00067627 predicted 750
6 SASI_Hs01_00067629 predicted 614
7 SASI_Hs01_00067630 predicted 1762
8 SASI_Hs01_00067631 predicted 1470
9 SASI_Hs01_00067632 predicted 1412
10 SASI_Hs01_00067633 predicted 623
11 SASI_Hs01_00067628 predicted 903
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373015 predicted 387
2 SASI_Hs01_00024909 predicted 686
3 SASI_Hs01_00024910 predicted 454
4 SASI_Hs01_00024911 predicted 1483
5 SASI_Hs01_00024912 predicted 643
6 SASI_Hs01_00024914 predicted 507
7 SASI_Hs01_00024915 predicted 1654
8 SASI_Hs01_00024916 predicted 1361
9 SASI_Hs01_00024917 predicted 1295
10 SASI_Hs01_00024918 predicted 517
11 SASI_Hs01_00024913 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373016 predicted 427
2 SASI_Hs01_00109175 predicted 725
3 SASI_Hs01_00109176 predicted 504
4 SASI_Hs01_00109177 predicted 1527
5 SASI_Hs01_00109178 predicted 689
6 SASI_Hs01_00109180 predicted 542
7 SASI_Hs01_00109181 predicted 1697
8 SASI_Hs01_00109182 predicted 1407
9 SASI_Hs01_00109183 predicted 1342
10 SASI_Hs01_00109184 predicted 558
11 SASI_Hs01_00109179 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373017 predicted 368
2 SASI_Hs01_00041912 predicted 663
3 SASI_Hs01_00041913 predicted 439
4 SASI_Hs01_00041914 predicted 1457
5 SASI_Hs01_00041915 predicted 625
6 SASI_Hs01_00041917 predicted 480
7 SASI_Hs01_00041918 predicted 1630
8 SASI_Hs01_00041919 predicted 1340
9 SASI_Hs01_00041920 predicted 1279
10 SASI_Hs01_00041921 predicted 491
11 SASI_Hs01_00041916 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373018 predicted 404
2 SASI_Hs01_00196170 predicted 707
3 SASI_Hs01_00196171 predicted 474
4 SASI_Hs01_00196172 predicted 1505
5 SASI_Hs01_00196173 predicted 658
6 SASI_Hs01_00196175 predicted 528
7 SASI_Hs01_00196176 predicted 1675
8 SASI_Hs01_00196177 predicted 1384
9 SASI_Hs01_00196178 predicted 1314
10 SASI_Hs01_00196179 predicted 537
11 SASI_Hs01_00196174 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373019 predicted 476
2 SASI_Hs01_00036056 predicted 771
3 SASI_Hs01_00036057 predicted 540
4 SASI_Hs01_00036058 predicted 1573
5 SASI_Hs01_00036059 predicted 727
6 SASI_Hs01_00036061 predicted 586
7 SASI_Hs01_00036062 predicted 1747
8 SASI_Hs01_00036063 predicted 1445
9 SASI_Hs01_00036064 predicted 1383
10 SASI_Hs01_00036065 predicted 600
11 SASI_Hs01_00036060 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373020 predicted 428
2 SASI_Hs01_00188910 predicted 732
3 SASI_Hs01_00188911 predicted 502
4 SASI_Hs01_00188912 predicted 1528
5 SASI_Hs01_00188913 predicted 689
6 SASI_Hs01_00188915 predicted 546
7 SASI_Hs01_00188916 predicted 1700
8 SASI_Hs01_00188917 predicted 1406
9 SASI_Hs01_00188918 predicted 1342
10 SASI_Hs01_00188919 predicted 564
11 SASI_Hs01_00188914 predicted 837
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044668 predicted 677
2 SASI_Rn01_00044669 predicted 425
3 SASI_Rn01_00044670 predicted 487
4 SASI_Rn01_00044671 predicted 440
5 SASI_Rn01_00044672 predicted 319
6 SASI_Rn01_00044673 predicted 961
7 SASI_Rn01_00044674 predicted 625
8 SASI_Rn01_00044675 predicted 665
9 SASI_Rn02_00267782 predicted 687
10 SASI_Rn01_00044676 predicted 1142
11 SASI_Rn01_00044677 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052469 predicted 518
2 SASI_Mm01_00052470 predicted 234
3 SASI_Mm01_00052472 predicted 431
4 SASI_Mm01_00052473 predicted 1149
5 SASI_Mm01_00052474 predicted 1130
6 SASI_Mm01_00052475 predicted 312
7 SASI_Mm01_00052476 predicted 476
8 SASI_Mm01_00052477 predicted 511
9 SASI_Mm01_00052478 predicted 413
10 SASI_Mm02_00322881 predicted 1148
11 SASI_Mm01_00052471 predicted 440
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016250
NDRG2 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-408s1c1
Sequence:CCGGCAGAACTTTGTGCGGGTTCATCTCGAGATGAACCCGCACAAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-714s1c1
Sequence:CCGGGAGATGATCCTTGGACATCTTCTCGAGAAGATGTCCAAGGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1528s1c1
Sequence:CCGGGTCCTGATCTAGGTGTCTATACTCGAGTATAGACACCTAGATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1765s1c1
Sequence:CCGGGATAGAAACATCCAGTGTAAACTCGAGTTTACACTGGATGTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-1189s1c1
Sequence:CCGGGCGAGTCTGGAACTCTTTCTTCTCGAGAAGAAAGAGTTCCAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-940s1c1
Sequence:CCGGCAGTGGTGGAATGTAACTCAACTCGAGTTGAGTTACATTCCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1430s1c1
Sequence:CCGGCTGGAAGAGATGTCCTAATATCTCGAGATATTAGGACATCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-576s21c1
Sequence:CCGGGCCTACATCCTGGCGAGATATCTCGAGATATCTCGCCAGGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-519s21c1
Sequence:CCGGTGCGTCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016250
NDRG2 MISSION shRNA shRNA Plasmid DNA
NDRG family member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-408s1c1
Sequence:CCGGCAGAACTTTGTGCGGGTTCATCTCGAGATGAACCCGCACAAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-714s1c1
Sequence:CCGGGAGATGATCCTTGGACATCTTCTCGAGAAGATGTCCAAGGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1528s1c1
Sequence:CCGGGTCCTGATCTAGGTGTCTATACTCGAGTATAGACACCTAGATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1765s1c1
Sequence:CCGGGATAGAAACATCCAGTGTAAACTCGAGTTTACACTGGATGTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-1189s1c1
Sequence:CCGGGCGAGTCTGGAACTCTTTCTTCTCGAGAAGAAAGAGTTCCAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-940s1c1
Sequence:CCGGCAGTGGTGGAATGTAACTCAACTCGAGTTGAGTTACATTCCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1430s1c1
Sequence:CCGGCTGGAAGAGATGTCCTAATATCTCGAGATATTAGGACATCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-576s21c1
Sequence:CCGGGCCTACATCCTGGCGAGATATCTCGAGATATCTCGCCAGGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-519s21c1
Sequence:CCGGTGCGTCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016250
NDRG2 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-408s1c1
Sequence:CCGGCAGAACTTTGTGCGGGTTCATCTCGAGATGAACCCGCACAAAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-714s1c1
Sequence:CCGGGAGATGATCCTTGGACATCTTCTCGAGAAGATGTCCAAGGATCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179158    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1528s1c1
Sequence:CCGGGTCCTGATCTAGGTGTCTATACTCGAGTATAGACACCTAGATCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183591    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1765s1c1
Sequence:CCGGGATAGAAACATCCAGTGTAAACTCGAGTTTACACTGGATGTTTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196222    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-1189s1c1
Sequence:CCGGGCGAGTCTGGAACTCTTTCTTCTCGAGAAGAAAGAGTTCCAGACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016250.2-940s1c1
Sequence:CCGGCAGTGGTGGAATGTAACTCAACTCGAGTTGAGTTACATTCCACCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150713    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016250.2-1430s1c1
Sequence:CCGGCTGGAAGAGATGTCCTAATATCTCGAGATATTAGGACATCTCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-576s21c1
Sequence:CCGGGCCTACATCCTGGCGAGATATCTCGAGATATCTCGCCAGGATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016250.2-519s21c1
Sequence:CCGGTGCGTCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGACGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013864
VALIDATED
NDRG2 MISSION shRNA Bacterial Glycerol Stock
NDRG family member 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-251s1c1
Sequence:CCGGCCTCAACTATAAGTCTTGCTTCTCGAGAAGCAAGACTTATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1696s1c1
Sequence:CCGGCGATCCTTAATGTGATAGAAACTCGAGTTTCTATCACATTAAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013864.1-225s1c1
Sequence:CCGGGCAATATTCACCTACCATGATCTCGAGATCATGGTAGGTGAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1695s1c1
Sequence:CCGGGCGATCCTTAATGTGATAGAACTCGAGTTCTATCACATTAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013864.1-1754s1c1
Sequence:CCGGCCCGTGAAGAACAGTGGTAAACTCGAGTTTACCACTGTTCTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-583s1c1
Sequence:CCGGCCCACAAGTTAACTGGCCTTACTCGAGTAAGGCCAGTTAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013864.1-423s21c1
Sequence:CCGGTGCATCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-1333s21c1
Sequence:CCGGCTAGGTGAGGTGTCCTAATATCTCGAGATATTAGGACACCTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-292s1c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-480s21c1
Sequence:CCGGGCCTACATTCTGTCGCGATATCTCGAGATATCGCGACAGAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-292s21c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-243s21c1
Sequence:CCGGGATGTAGGCCTCAACTATAAGCTCGAGCTTATAGTTGAGGCCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013864
VALIDATED
NDRG2 MISSION shRNA shRNA Plasmid DNA
NDRG family member 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-251s1c1
Sequence:CCGGCCTCAACTATAAGTCTTGCTTCTCGAGAAGCAAGACTTATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1696s1c1
Sequence:CCGGCGATCCTTAATGTGATAGAAACTCGAGTTTCTATCACATTAAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013864.1-225s1c1
Sequence:CCGGGCAATATTCACCTACCATGATCTCGAGATCATGGTAGGTGAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1695s1c1
Sequence:CCGGGCGATCCTTAATGTGATAGAACTCGAGTTCTATCACATTAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013864.1-1754s1c1
Sequence:CCGGCCCGTGAAGAACAGTGGTAAACTCGAGTTTACCACTGTTCTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-583s1c1
Sequence:CCGGCCCACAAGTTAACTGGCCTTACTCGAGTAAGGCCAGTTAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013864.1-423s21c1
Sequence:CCGGTGCATCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-1333s21c1
Sequence:CCGGCTAGGTGAGGTGTCCTAATATCTCGAGATATTAGGACACCTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-292s1c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-480s21c1
Sequence:CCGGGCCTACATTCTGTCGCGATATCTCGAGATATCGCGACAGAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-292s21c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-243s21c1
Sequence:CCGGGATGTAGGCCTCAACTATAAGCTCGAGCTTATAGTTGAGGCCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013864
VALIDATED
NDRG2 MISSION shRNA Lentiviral Transduction Particles
NDRG family member 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177600    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-251s1c1
Sequence:CCGGCCTCAACTATAAGTCTTGCTTCTCGAGAAGCAAGACTTATAGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176560    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1696s1c1
Sequence:CCGGCGATCCTTAATGTGATAGAAACTCGAGTTTCTATCACATTAAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013864.1-225s1c1
Sequence:CCGGGCAATATTCACCTACCATGATCTCGAGATCATGGTAGGTGAATATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013864.1-1695s1c1
Sequence:CCGGGCGATCCTTAATGTGATAGAACTCGAGTTCTATCACATTAAGGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013864.1-1754s1c1
Sequence:CCGGCCCGTGAAGAACAGTGGTAAACTCGAGTTTACCACTGTTCTTCACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-583s1c1
Sequence:CCGGCCCACAAGTTAACTGGCCTTACTCGAGTAAGGCCAGTTAACTTGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013864.1-423s21c1
Sequence:CCGGTGCATCCTGCAGTACCTAAATCTCGAGATTTAGGTACTGCAGGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-1333s21c1
Sequence:CCGGCTAGGTGAGGTGTCCTAATATCTCGAGATATTAGGACACCTCACCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217477    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013864.1-292s1c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-480s21c1
Sequence:CCGGGCCTACATTCTGTCGCGATATCTCGAGATATCGCGACAGAATGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-292s21c1
Sequence:CCGGGGGATATGCAAGAGATCATACCTCGAGGTATGATCTCTTGCATATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013864.1-243s21c1
Sequence:CCGGGATGTAGGCCTCAACTATAAGCTCGAGCTTATAGTTGAGGCCTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks