EMAIL THIS PAGE TO A FRIEND

NDST3

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3

Synonyms: HSST3
UniProtKB ID: O95803, Q4W5C1, Q4W5D0, Q6UWC5, Q9UP21
Gene ID:
Human(9348) Summary: This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
Mouse(83398) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Rat(295430) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Zebrafish(100317129) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
dog(487918) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
domestic cat(101095009) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
cow(524136) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Horse(100064122) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
chicken(428769) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
sheep(101111805) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
domestic guinea pig(100719907) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
naked mole-rat(101708542) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Domestic Rabbit(100350425) N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031186 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031186 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031186 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004784 Rosetta Predictions human pricing
XM_001075487 Rosetta Predictions rat pricing
XM_227665 Rosetta Predictions rat pricing
NM_031186 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128878 predicted 1872
2 SASI_Hs01_00128879 predicted 1012
3 SASI_Hs01_00128880 predicted 2059
4 SASI_Hs01_00128881 predicted 700
5 SASI_Hs02_00338297 predicted 424
6 SASI_Hs01_00128883 predicted 2476
7 SASI_Hs02_00338298 predicted 1361
8 SASI_Hs01_00128884 predicted 831
9 SASI_Hs01_00128885 predicted 1762
10 SASI_Hs02_00338299 predicted 745
11 SASI_Hs01_00128876 predicted 2296
12 SASI_Hs01_00128877 predicted 2762
13 SASI_Hs01_00128882 predicted 2405
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349924 predicted 2052
2 SASI_Rn02_00349925 predicted 1584
3 SASI_Rn02_00349926 predicted 583
4 SASI_Rn02_00349927 predicted 525
5 SASI_Rn02_00349928 predicted 2210
6 SASI_Rn02_00349929 predicted 2036
7 SASI_Rn02_00349930 predicted 2087
8 SASI_Rn02_00349931 predicted 2151
9 SASI_Rn02_00349932 predicted 1169
10 SASI_Rn02_00349933 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384595 predicted 1582
2 SASI_Rn02_00384596 predicted 581
3 SASI_Rn02_00384597 predicted 527
4 SASI_Rn02_00384598 predicted 2209
5 SASI_Rn02_00384599 predicted 2034
6 SASI_Rn02_00384600 predicted 2084
7 SASI_Rn02_00384601 predicted 2154
8 SASI_Rn02_00384602 predicted 1175
9 SASI_Rn02_00384603 predicted 1503
10 SASI_Rn02_00384604 predicted 314
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031186 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180648 predicted 1962
2 SASI_Mm01_00180650 predicted 2350
3 SASI_Mm01_00180651 predicted 2561
4 SASI_Mm01_00180652 predicted 235
5 SASI_Mm01_00180653 predicted 545
6 SASI_Mm01_00180654 predicted 1958
7 SASI_Mm01_00180655 predicted 1660
8 SASI_Mm01_00180656 predicted 2004
9 SASI_Mm02_00337029 predicted 367
10 SASI_Mm01_00180657 predicted 322
11 SASI_Mm01_00180649 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004784
NDST3 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-840s21c1
Sequence:CCGGATCGAAGCCTTCTAGATAAATCTCGAGATTTATCTAGAAGGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-563s21c1
Sequence:CCGGGACCTCCAACACCTACCATATCTCGAGATATGGTAGGTGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-635s1c1
Sequence:CCGGCCCACAGTCCTAGTATTTGTACTCGAGTACAAATACTAGGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2683s1c1
Sequence:CCGGCCCATTTCAGTTGCTAATTATCTCGAGATAATTAGCAACTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-1411s1c1
Sequence:CCGGGCGTGCACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2802s1c1
Sequence:CCGGCGTTTGATTCTCATAAAGGTTCTCGAGAACCTTTATGAGAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2231s1c1
Sequence:CCGGGCTTTGTATTTGTTCCTGGTTCTCGAGAACCAGGAACAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004784
NDST3 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-840s21c1
Sequence:CCGGATCGAAGCCTTCTAGATAAATCTCGAGATTTATCTAGAAGGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-563s21c1
Sequence:CCGGGACCTCCAACACCTACCATATCTCGAGATATGGTAGGTGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-635s1c1
Sequence:CCGGCCCACAGTCCTAGTATTTGTACTCGAGTACAAATACTAGGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2683s1c1
Sequence:CCGGCCCATTTCAGTTGCTAATTATCTCGAGATAATTAGCAACTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-1411s1c1
Sequence:CCGGGCGTGCACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2802s1c1
Sequence:CCGGCGTTTGATTCTCATAAAGGTTCTCGAGAACCTTTATGAGAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2231s1c1
Sequence:CCGGGCTTTGTATTTGTTCCTGGTTCTCGAGAACCAGGAACAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004784
NDST3 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-840s21c1
Sequence:CCGGATCGAAGCCTTCTAGATAAATCTCGAGATTTATCTAGAAGGCTTCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004784.2-563s21c1
Sequence:CCGGGACCTCCAACACCTACCATATCTCGAGATATGGTAGGTGTTGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-635s1c1
Sequence:CCGGCCCACAGTCCTAGTATTTGTACTCGAGTACAAATACTAGGACTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2683s1c1
Sequence:CCGGCCCATTTCAGTTGCTAATTATCTCGAGATAATTAGCAACTGAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-1411s1c1
Sequence:CCGGGCGTGCACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2802s1c1
Sequence:CCGGCGTTTGATTCTCATAAAGGTTCTCGAGAACCTTTATGAGAATCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004784.1-2231s1c1
Sequence:CCGGGCTTTGTATTTGTTCCTGGTTCTCGAGAACCAGGAACAAATACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031186
NDST3 MISSION shRNA Bacterial Glycerol Stock
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031186.2-4748s1c1
Sequence:CCGGGCTGACATACATCTCCACATTCTCGAGAATGTGGAGATGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-378s1c1
Sequence:CCGGCGGTTCCATTATCACACTGAACTCGAGTTCAGTGTGATAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2217s1c1
Sequence:CCGGGCTCTGAAATTTAGCTTCTATCTCGAGATAGAAGCTAAATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-1079s1c1
Sequence:CCGGGCGCACACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2348s1c1
Sequence:CCGGCCCTCCATTTCAGTTGCTAATCTCGAGATTAGCAACTGAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031186
NDST3 MISSION shRNA shRNA Plasmid DNA
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031186.2-4748s1c1
Sequence:CCGGGCTGACATACATCTCCACATTCTCGAGAATGTGGAGATGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-378s1c1
Sequence:CCGGCGGTTCCATTATCACACTGAACTCGAGTTCAGTGTGATAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2217s1c1
Sequence:CCGGGCTCTGAAATTTAGCTTCTATCTCGAGATAGAAGCTAAATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-1079s1c1
Sequence:CCGGGCGCACACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2348s1c1
Sequence:CCGGCCCTCCATTTCAGTTGCTAATCTCGAGATTAGCAACTGAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031186
NDST3 MISSION shRNA Lentiviral Transduction Particles
N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097825    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031186.2-4748s1c1
Sequence:CCGGGCTGACATACATCTCCACATTCTCGAGAATGTGGAGATGTATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-378s1c1
Sequence:CCGGCGGTTCCATTATCACACTGAACTCGAGTTCAGTGTGATAATGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2217s1c1
Sequence:CCGGGCTCTGAAATTTAGCTTCTATCTCGAGATAGAAGCTAAATTTCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-1079s1c1
Sequence:CCGGGCGCACACAAATCACAAATTTCTCGAGAAATTTGTGATTTGTGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031186.2-2348s1c1
Sequence:CCGGCCCTCCATTTCAGTTGCTAATCTCGAGATTAGCAACTGAAATGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks