EMAIL THIS PAGE TO A FRIEND

NDUFA10

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa

Synonyms: CI-42KD CI-42k
UniProtKB ID: O95299
Gene ID:
Human(4705) Summary: The protein encoded by this gene belongs to the complex I 42kDA subunit family. Mammalian complex I is the first enzyme complex in the electron transport chain of mitochondria. It is composed of 45 different subunits. This protein is a component of the hydrophobic protein fraction and has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. [provided by RefSeq, Jul 2008]
Mouse(67273) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10
Rat(678759) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10
naked mole-rat(101698851) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
domestic guinea pig(100727327) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
sheep(101122393) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Zebrafish(321951) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10
cow(338060) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
domestic cat(101093631) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
dog(608244) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
chicken(424032) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024197 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024197 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024197 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004544 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004544 Rosetta Predictions human pricing
NM_199495 Rosetta Predictions rat pricing
XM_001053046 Rosetta Predictions rat pricing
NM_024197 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124032 predicted 731
2 SASI_Hs01_00124033 predicted 1117
3 SASI_Hs01_00124034 predicted 592
4 SASI_Hs01_00124035 predicted 248
5 SASI_Hs01_00124036 predicted 247
6 SASI_Hs01_00124037 predicted 398
7 SASI_Hs01_00124038 predicted 1089
8 SASI_Hs01_00124039 predicted 441
9 SASI_Hs01_00124040 predicted 779
10 SASI_Hs01_00124041 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270261 predicted 244
2 SASI_Rn01_00064399 predicted 893
3 SASI_Rn02_00270262 predicted 221
4 SASI_Rn02_00270263 predicted 232
5 SASI_Rn01_00064400 predicted 711
6 SASI_Rn01_00064401 predicted 369
7 SASI_Rn02_00270264 predicted 1095
8 SASI_Rn01_00064403 predicted 805
9 SASI_Rn02_00270265 predicted 242
10 SASI_Rn02_00270266 predicted 1181
11 SASI_Rn01_00064402 predicted 217
12 SASI_Rn01_00064404 predicted 678
13 SASI_Rn01_00064405 predicted 699
14 SASI_Rn01_00064406 predicted 706
15 SASI_Rn01_00064407 predicted 285
16 SASI_Rn01_00064408 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271130 predicted 202
2 SASI_Rn02_00271131 predicted 855
3 SASI_Rn02_00271132 predicted 678
4 SASI_Rn02_00271133 predicted 337
5 SASI_Rn02_00271134 predicted 1055
6 SASI_Rn02_00271135 predicted 760
7 SASI_Rn02_00271136 predicted 1158
8 SASI_Rn02_00271137 predicted 203
9 SASI_Rn02_00271138 predicted 1143
10 SASI_Rn02_00271139 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024197 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114531 predicted 483
2 SASI_Mm02_00327533 predicted 203
3 SASI_Mm01_00114532 predicted 671
4 SASI_Mm01_00114533 predicted 334
5 SASI_Mm01_00114535 predicted 901
6 SASI_Mm01_00114536 predicted 559
7 SASI_Mm01_00114538 predicted 831
8 SASI_Mm01_00114539 predicted 979
9 SASI_Mm01_00114540 predicted 387
10 SASI_Mm02_00327534 predicted 537
11 SASI_Mm01_00114534 predicted 541
12 SASI_Mm01_00114537 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024197
VALIDATED
NDUFA10 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-997s1c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-931s1c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-350s1c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-535s1c1
Sequence:CCGGGCAATGTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-153s1c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-997s21c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-931s21c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-350s21c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-153s21c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024197
VALIDATED
NDUFA10 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-997s1c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-931s1c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-350s1c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-535s1c1
Sequence:CCGGGCAATGTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-153s1c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-997s21c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-931s21c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-350s21c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-153s21c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024197
VALIDATED
NDUFA10 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-997s1c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-931s1c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-350s1c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-535s1c1
Sequence:CCGGGCAATGTACAACCAGGGCTATCTCGAGATAGCCCTGGTTGTACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024197.1-153s1c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-997s21c1
Sequence:CCGGCGGATCTACAACAGCTTCAGACTCGAGTCTGAAGCTGTTGTAGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-931s21c1
Sequence:CCGGGTGCTGAATTACACGACCATTCTCGAGAATGGTCGTGTAATTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-350s21c1
Sequence:CCGGGCAGCTGTAGTTTAGAGAAATCTCGAGATTTCTCTAAACTACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024197.1-153s21c1
Sequence:CCGGTCTTGGTGATAAGACAACCAACTCGAGTTGGTTGTCTTATCACCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004544
NDUFA10 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-935s1c1
Sequence:CCGGGCAGGACAATCGCACTTTATACTCGAGTATAAAGTGCGATTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-246s1c1
Sequence:CCGGCGCAGCAGAGTGATAACTGTACTCGAGTACAGTTATCACTCTGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-397s1c1
Sequence:CCGGCCGACTATAATGGCAACTGTACTCGAGTACAGTTGCCATTATAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-990s1c1
Sequence:CCGGGTGCTGAATTACACAAGCATTCTCGAGAATGCTTGTGTAATTCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-188s1c1
Sequence:CCGGGCGCTATGGAATGTGGCATTTCTCGAGAAATGCCACATTCCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-988s21c1
Sequence:CCGGTACTGGTTCAGGATAAGTTTGCTCGAGCAAACTTATCCTGAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-921s21c1
Sequence:CCGGGAATACCTGAAGTTCGATAAACTCGAGTTTATCGAACTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004544
NDUFA10 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-935s1c1
Sequence:CCGGGCAGGACAATCGCACTTTATACTCGAGTATAAAGTGCGATTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-246s1c1
Sequence:CCGGCGCAGCAGAGTGATAACTGTACTCGAGTACAGTTATCACTCTGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-397s1c1
Sequence:CCGGCCGACTATAATGGCAACTGTACTCGAGTACAGTTGCCATTATAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-990s1c1
Sequence:CCGGGTGCTGAATTACACAAGCATTCTCGAGAATGCTTGTGTAATTCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-188s1c1
Sequence:CCGGGCGCTATGGAATGTGGCATTTCTCGAGAAATGCCACATTCCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-988s21c1
Sequence:CCGGTACTGGTTCAGGATAAGTTTGCTCGAGCAAACTTATCCTGAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-921s21c1
Sequence:CCGGGAATACCTGAAGTTCGATAAACTCGAGTTTATCGAACTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004544
NDUFA10 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 10, 42kDa
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-935s1c1
Sequence:CCGGGCAGGACAATCGCACTTTATACTCGAGTATAAAGTGCGATTGTCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-246s1c1
Sequence:CCGGCGCAGCAGAGTGATAACTGTACTCGAGTACAGTTATCACTCTGCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-397s1c1
Sequence:CCGGCCGACTATAATGGCAACTGTACTCGAGTACAGTTGCCATTATAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-990s1c1
Sequence:CCGGGTGCTGAATTACACAAGCATTCTCGAGAATGCTTGTGTAATTCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004544.2-188s1c1
Sequence:CCGGGCGCTATGGAATGTGGCATTTCTCGAGAAATGCCACATTCCATAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-988s21c1
Sequence:CCGGTACTGGTTCAGGATAAGTTTGCTCGAGCAAACTTATCCTGAACCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004544.3-921s21c1
Sequence:CCGGGAATACCTGAAGTTCGATAAACTCGAGTTTATCGAACTTCAGGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks