EMAIL THIS PAGE TO A FRIEND

NDUFA12

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12

Synonyms: B17.2 DAP13
UniProtKB ID: Q9UI09, F8VQS7, Q53XX0, Q9BRV6
Gene ID:
Human(55967) Summary: This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]
Mouse(66414) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Rat(299739) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Zebrafish(556538) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
domestic cat(101081479) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
cow(281742) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
dog(475428) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
chicken(417907) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
sheep(100270720) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
naked mole-rat(101710903) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
domestic guinea pig(100730492) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018838 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018838 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018838 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018838 Rosetta Predictions human pricing
NM_001106781 Rosetta Predictions rat pricing
NM_025551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018838 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051718 predicted 223
2 SASI_Hs02_00352288 predicted 261
3 SASI_Hs01_00051720 predicted 248
4 SASI_Hs01_00051721 predicted 225
5 SASI_Hs01_00051723 predicted 217
6 SASI_Hs01_00051724 predicted 360
7 SASI_Hs02_00352289 predicted 236
8 SASI_Hs01_00051725 predicted 224
9 SASI_Hs02_00352290 predicted 352
10 SASI_Hs01_00051726 predicted 229
11 SASI_Hs01_00051719 predicted 341
12 SASI_Hs01_00051722 predicted 277
13 SASI_Hs01_00051727 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106781 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222338 predicted 319
2 SASI_Rn02_00222339 predicted 318
3 SASI_Rn02_00222340 predicted 318
4 SASI_Rn02_00222341 predicted 210
5 SASI_Rn02_00222342 predicted 197
6 SASI_Rn02_00222343 predicted 283
7 SASI_Rn02_00222344 predicted 209
8 SASI_Rn02_00222345 predicted 198
9 SASI_Rn02_00222346 predicted 294
10 SASI_Rn02_00222347 predicted 275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186306 predicted 200
2 SASI_Mm01_00186307 predicted 252
3 SASI_Mm01_00186308 predicted 229
4 SASI_Mm01_00186309 predicted 225
5 SASI_Mm01_00186310 predicted 339
6 SASI_Mm01_00186311 predicted 293
7 SASI_Mm01_00186312 predicted 338
8 SASI_Mm01_00186313 predicted 200
9 SASI_Mm01_00186314 predicted 208
10 SASI_Mm02_00328496 predicted 199
11 SASI_Mm01_00186305 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025551
VALIDATED
NDUFA12 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.1-149s1c1
Sequence:CCGGCTGGTGGGAGAAGACAAATATCTCGAGATATTTGTCTTCTCCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-399s1c1
Sequence:CCGGCAGAGCAATACGTTCCTTATTCTCGAGAATAAGGAACGTATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-345s1c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-396s1c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-181s1c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-364s1c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-169s1c1
Sequence:CCGGGGAAATAAATACTACGAAGACCTCGAGGTCTTCGTAGTATTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-344s21c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-180s21c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-363s21c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025551.3-395s21c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-130s1c1
Sequence:CCGGGATATAAGGATTGGTACACTGCTCGAGCAGTGTACCAATCCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-117s1c1
Sequence:CCGGCTTCAGGGCAAATGATATAAGCTCGAGCTTATATCATTTGCCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025551
VALIDATED
NDUFA12 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.1-149s1c1
Sequence:CCGGCTGGTGGGAGAAGACAAATATCTCGAGATATTTGTCTTCTCCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-399s1c1
Sequence:CCGGCAGAGCAATACGTTCCTTATTCTCGAGAATAAGGAACGTATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-345s1c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-396s1c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-181s1c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-364s1c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-169s1c1
Sequence:CCGGGGAAATAAATACTACGAAGACCTCGAGGTCTTCGTAGTATTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-344s21c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-180s21c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-363s21c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025551.3-395s21c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-130s1c1
Sequence:CCGGGATATAAGGATTGGTACACTGCTCGAGCAGTGTACCAATCCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-117s1c1
Sequence:CCGGCTTCAGGGCAAATGATATAAGCTCGAGCTTATATCATTTGCCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025551
VALIDATED
NDUFA12 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198179    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.1-149s1c1
Sequence:CCGGCTGGTGGGAGAAGACAAATATCTCGAGATATTTGTCTTCTCCCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-399s1c1
Sequence:CCGGCAGAGCAATACGTTCCTTATTCTCGAGAATAAGGAACGTATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-345s1c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-396s1c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-181s1c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025551.1-364s1c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215507    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-169s1c1
Sequence:CCGGGGAAATAAATACTACGAAGACCTCGAGGTCTTCGTAGTATTTATTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-344s21c1
Sequence:CCGGCGACTGCTCGTAAATTCATCTCTCGAGAGATGAATTTACGAGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-180s21c1
Sequence:CCGGCTACGAAGACAACAAGCAATTCTCGAGAATTGCTTGTTGTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025551.3-363s21c1
Sequence:CCGGCTGGACAAACCATAAATTCAACTCGAGTTGAATTTATGGTTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025551.3-395s21c1
Sequence:CCGGCTCCAGAGCAATACGTTCCTTCTCGAGAAGGAACGTATTGCTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-130s1c1
Sequence:CCGGGATATAAGGATTGGTACACTGCTCGAGCAGTGTACCAATCCTTATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215830    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025551.3-117s1c1
Sequence:CCGGCTTCAGGGCAAATGATATAAGCTCGAGCTTATATCATTTGCCCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018838
VALIDATED
NDUFA12 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-333s1c1
Sequence:CCGGTGACTGATGATCCTCCAACAACTCGAGTTGTTGGAGGATCATCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-415s1c1
Sequence:CCGGCCCAGAACAATATGTACCTTACTCGAGTAAGGTACATATTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-227s1c1
Sequence:CCGGCGTCACCGATGGGTTGTATATCTCGAGATATACAACCCATCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-387s1c1
Sequence:CCGGCGAACCATAAATTCAACGTGACTCGAGTCACGTTGAATTTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-149s1c1
Sequence:CCGGGATGCGAAGGTTGGTACATTACTCGAGTAATGTACCAACCTTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-282s21c1
Sequence:CCGGATGTGGATGGAAGCATGGTGCCTCGAGGCACCATGCTTCCATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-461s21c1
Sequence:CCGGGAGTGGATCCCACCTTCAACACTCGAGTGTTGAAGGTGGGATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-376s21c1
Sequence:CCGGATTCATTTGGACGAACCATAACTCGAGTTATGGTTCGTCCAAATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-314s21c1
Sequence:CCGGCATCGTTGGCTTCACAGTATGCTCGAGCATACTGTGAAGCCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-440s21c1
Sequence:CCGGACCACTAGAAAGAAGATTCAGCTCGAGCTGAATCTTCTTTCTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-358s21c1
Sequence:CCGGACCACTTACTGCTCGTAAATTCTCGAGAATTTACGAGCAGTAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-300s21c1
Sequence:CCGGTGCCTCCTGAATGGCATCGTTCTCGAGAACGATGCCATTCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018838
VALIDATED
NDUFA12 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-333s1c1
Sequence:CCGGTGACTGATGATCCTCCAACAACTCGAGTTGTTGGAGGATCATCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-415s1c1
Sequence:CCGGCCCAGAACAATATGTACCTTACTCGAGTAAGGTACATATTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-227s1c1
Sequence:CCGGCGTCACCGATGGGTTGTATATCTCGAGATATACAACCCATCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-387s1c1
Sequence:CCGGCGAACCATAAATTCAACGTGACTCGAGTCACGTTGAATTTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-149s1c1
Sequence:CCGGGATGCGAAGGTTGGTACATTACTCGAGTAATGTACCAACCTTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-282s21c1
Sequence:CCGGATGTGGATGGAAGCATGGTGCCTCGAGGCACCATGCTTCCATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-461s21c1
Sequence:CCGGGAGTGGATCCCACCTTCAACACTCGAGTGTTGAAGGTGGGATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-376s21c1
Sequence:CCGGATTCATTTGGACGAACCATAACTCGAGTTATGGTTCGTCCAAATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-314s21c1
Sequence:CCGGCATCGTTGGCTTCACAGTATGCTCGAGCATACTGTGAAGCCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-440s21c1
Sequence:CCGGACCACTAGAAAGAAGATTCAGCTCGAGCTGAATCTTCTTTCTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-358s21c1
Sequence:CCGGACCACTTACTGCTCGTAAATTCTCGAGAATTTACGAGCAGTAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-300s21c1
Sequence:CCGGTGCCTCCTGAATGGCATCGTTCTCGAGAACGATGCCATTCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018838
VALIDATED
NDUFA12 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-333s1c1
Sequence:CCGGTGACTGATGATCCTCCAACAACTCGAGTTGTTGGAGGATCATCAGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-415s1c1
Sequence:CCGGCCCAGAACAATATGTACCTTACTCGAGTAAGGTACATATTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-227s1c1
Sequence:CCGGCGTCACCGATGGGTTGTATATCTCGAGATATACAACCCATCGGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018838.3-387s1c1
Sequence:CCGGCGAACCATAAATTCAACGTGACTCGAGTCACGTTGAATTTATGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A3
TRC Version: 1 Clone ID:NM_018838.3-149s1c1
Sequence:CCGGGATGCGAAGGTTGGTACATTACTCGAGTAATGTACCAACCTTCGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-282s21c1
Sequence:CCGGATGTGGATGGAAGCATGGTGCCTCGAGGCACCATGCTTCCATCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-461s21c1
Sequence:CCGGGAGTGGATCCCACCTTCAACACTCGAGTGTTGAAGGTGGGATCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-376s21c1
Sequence:CCGGATTCATTTGGACGAACCATAACTCGAGTTATGGTTCGTCCAAATGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-314s21c1
Sequence:CCGGCATCGTTGGCTTCACAGTATGCTCGAGCATACTGTGAAGCCAACGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-440s21c1
Sequence:CCGGACCACTAGAAAGAAGATTCAGCTCGAGCTGAATCTTCTTTCTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-358s21c1
Sequence:CCGGACCACTTACTGCTCGTAAATTCTCGAGAATTTACGAGCAGTAAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018838.3-300s21c1
Sequence:CCGGTGCCTCCTGAATGGCATCGTTCTCGAGAACGATGCCATTCAGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks