EMAIL THIS PAGE TO A FRIEND

NDUFA3

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa

Synonyms: B9 CI-B9
UniProtKB ID: O95167
Gene ID:
Mouse(66091) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3
Rat(691001) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3
cow(338064) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
domestic cat(101081685) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
dog(611480) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
sheep(101103257) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
naked mole-rat(101696601) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
domestic guinea pig(100713076) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004542 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004542 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004542 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058491 MISSION® esiRNA esiRNA human NDUFA3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004542 Rosetta Predictions human pricing
XM_001076462 Rosetta Predictions rat pricing
NM_025348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004542 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030179 predicted 185
2 SASI_Hs01_00030180 predicted 189
3 SASI_Hs01_00030181 predicted 178
4 SASI_Hs01_00030182 predicted 30
5 SASI_Hs01_00030183 predicted 184
6 SASI_Hs01_00030184 predicted 33
7 SASI_Hs01_00030186 predicted 68
8 SASI_Hs01_00030187 predicted 178
9 SASI_Hs01_00030188 predicted 35
10 SASI_Hs02_00337853 predicted 55
11 SASI_Hs01_00030185 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353322 predicted 268
2 SASI_Rn02_00353323 predicted 21
3 SASI_Rn02_00353324 predicted 265
4 SASI_Rn02_00353325 predicted 131
5 SASI_Rn02_00353326 predicted 241
6 SASI_Rn02_00353327 predicted 263
7 SASI_Rn02_00353328 predicted 21
8 SASI_Rn02_00353329 predicted 310
9 SASI_Rn02_00353330 predicted 100
10 SASI_Rn02_00353331 predicted 92
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129846 predicted 274
2 SASI_Mm02_00328015 predicted 30
3 SASI_Mm01_00129847 predicted 131
4 SASI_Mm01_00129848 predicted 302
5 SASI_Mm01_00129849 predicted 304
6 SASI_Mm01_00129855 predicted 269
7 SASI_Mm02_00328016 predicted 99
8 SASI_Mm02_00328017 predicted 106
9 SASI_Mm02_00328018 predicted 104
10 SASI_Mm01_00129850 predicted 247
11 SASI_Mm01_00129851 predicted 280
12 SASI_Mm01_00129852 predicted 198
13 SASI_Mm01_00129853 predicted 143
14 SASI_Mm01_00129854 predicted 257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025348
VALIDATED
NDUFA3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-193s21c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-136s21c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-52s21c1
Sequence:CCGGCAAGAATGCCTGGGCGAAGGACTCGAGTCCTTCGCCCAGGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-167s21c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-154s21c1
Sequence:CCGGCATGATCAACAAGGCCACACCCTCGAGGGTGTGGCCTTGTTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-111s1c1
Sequence:CCGGCGCTATAATTATGCCCATGATCTCGAGATCATGGGCATAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-169s1c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-195s1c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-138s1c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025348.1-144s1c1
Sequence:CCGGCAAGTATGCTAGCATGATCAACTCGAGTTGATCATGCTAGCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025348
VALIDATED
NDUFA3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-193s21c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-136s21c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-52s21c1
Sequence:CCGGCAAGAATGCCTGGGCGAAGGACTCGAGTCCTTCGCCCAGGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-167s21c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-154s21c1
Sequence:CCGGCATGATCAACAAGGCCACACCCTCGAGGGTGTGGCCTTGTTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-111s1c1
Sequence:CCGGCGCTATAATTATGCCCATGATCTCGAGATCATGGGCATAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-169s1c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-195s1c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-138s1c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025348.1-144s1c1
Sequence:CCGGCAAGTATGCTAGCATGATCAACTCGAGTTGATCATGCTAGCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025348
VALIDATED
NDUFA3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-193s21c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-136s21c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-52s21c1
Sequence:CCGGCAAGAATGCCTGGGCGAAGGACTCGAGTCCTTCGCCCAGGCATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-167s21c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025348.2-154s21c1
Sequence:CCGGCATGATCAACAAGGCCACACCCTCGAGGGTGTGGCCTTGTTGATCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-111s1c1
Sequence:CCGGCGCTATAATTATGCCCATGATCTCGAGATCATGGGCATAATTATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-169s1c1
Sequence:CCGGGCCACACCCTACAACTACCCACTCGAGTGGGTAGTTGTAGGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-195s1c1
Sequence:CCGGTGTGAGAGATGACGGGAACATCTCGAGATGTTCCCGTCATCTCTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025348.1-138s1c1
Sequence:CCGGCTACACCAAGTATGCTAGCATCTCGAGATGCTAGCATACTTGGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025348.1-144s1c1
Sequence:CCGGCAAGTATGCTAGCATGATCAACTCGAGTTGATCATGCTAGCATACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004542
VALIDATED
NDUFA3 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-138s21c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-184s21c1
Sequence:CCGGTACCCAGTGCCCGTCCGTGATCTCGAGATCACGGACGGGCACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-172s21c1
Sequence:CCGGACGCCCTACAACTACCCAGTGCTCGAGCACTGGGTAGTTGTAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-206s21c1
Sequence:CCGGATGGGAACATGCCCGACGTGCCTCGAGGCACGTCGGGCATGTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-160s1c1
Sequence:CCGGGATCAACAAGGCCACGCCCTACTCGAGTAGGGCGTGGCCTTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-82s1c1
Sequence:CCGGGCTGGTCGTGTCCTTCGTCGTCTCGAGACGACGAAGGACACGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-55s1c1
Sequence:CCGGCAAGAATGCCTGGGACAAGGACTCGAGTCCTTGTCCCAGGCATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004542.1-196s1c1
Sequence:CCGGCGTCCGTGATGATGGGAACATCTCGAGATGTTCCCATCATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-139s1c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004542
VALIDATED
NDUFA3 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-138s21c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-184s21c1
Sequence:CCGGTACCCAGTGCCCGTCCGTGATCTCGAGATCACGGACGGGCACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-172s21c1
Sequence:CCGGACGCCCTACAACTACCCAGTGCTCGAGCACTGGGTAGTTGTAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-206s21c1
Sequence:CCGGATGGGAACATGCCCGACGTGCCTCGAGGCACGTCGGGCATGTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-160s1c1
Sequence:CCGGGATCAACAAGGCCACGCCCTACTCGAGTAGGGCGTGGCCTTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-82s1c1
Sequence:CCGGGCTGGTCGTGTCCTTCGTCGTCTCGAGACGACGAAGGACACGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-55s1c1
Sequence:CCGGCAAGAATGCCTGGGACAAGGACTCGAGTCCTTGTCCCAGGCATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004542.1-196s1c1
Sequence:CCGGCGTCCGTGATGATGGGAACATCTCGAGATGTTCCCATCATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-139s1c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004542
VALIDATED
NDUFA3 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 3, 9kDa
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-138s21c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-184s21c1
Sequence:CCGGTACCCAGTGCCCGTCCGTGATCTCGAGATCACGGACGGGCACTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-172s21c1
Sequence:CCGGACGCCCTACAACTACCCAGTGCTCGAGCACTGGGTAGTTGTAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_004542.3-206s21c1
Sequence:CCGGATGGGAACATGCCCGACGTGCCTCGAGGCACGTCGGGCATGTTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-160s1c1
Sequence:CCGGGATCAACAAGGCCACGCCCTACTCGAGTAGGGCGTGGCCTTGTTGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-82s1c1
Sequence:CCGGGCTGGTCGTGTCCTTCGTCGTCTCGAGACGACGAAGGACACGACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-55s1c1
Sequence:CCGGCAAGAATGCCTGGGACAAGGACTCGAGTCCTTGTCCCAGGCATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004542.1-196s1c1
Sequence:CCGGCGTCCGTGATGATGGGAACATCTCGAGATGTTCCCATCATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004542.1-139s1c1
Sequence:CCGGCTACTTCAAGTACTCCGTCATCTCGAGATGACGGAGTACTTGAAGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks