EMAIL THIS PAGE TO A FRIEND

NDUFA4L2

NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2

Synonyms: NUOMS
UniProtKB ID: Q9NRX3, Q6IAH9
Gene ID:
Mouse(407790) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Rat(100362331) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Zebrafish(100003066) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
cow(613541) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
domestic cat(101091711) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
dog(607407) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
sheep(101123455) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
domestic guinea pig(100725678) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
naked mole-rat(101721074) NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001098789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001098789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020142 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020142 Rosetta Predictions human pricing
NM_001098789 Rosetta Predictions mouse pricing
XM_001004703 Rosetta Predictions mouse pricing
XM_001004705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055686 predicted 816
2 SASI_Hs01_00055682 predicted 854
3 SASI_Hs01_00055690 predicted 506
4 SASI_Hs01_00055683 predicted 398
5 SASI_Hs01_00055691 predicted 471
6 SASI_Hs02_00353029 predicted 484
7 SASI_Hs02_00353030 predicted 476
8 SASI_Hs01_00055684 predicted 860
9 SASI_Hs01_00055685 predicted 918
10 SASI_Hs01_00055687 predicted 839
11 SASI_Hs01_00055688 predicted 716
12 SASI_Hs01_00055689 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301441 predicted 303
2 SASI_Mm02_00301442 predicted 225
3 SASI_Mm02_00301443 predicted 285
4 SASI_Mm02_00301444 predicted 256
5 SASI_Mm02_00301445 predicted 600
6 SASI_Mm02_00301446 predicted 236
7 SASI_Mm02_00301447 predicted 371
8 SASI_Mm02_00301448 predicted 504
9 SASI_Mm02_00301449 predicted 314
10 SASI_Mm02_00301450 predicted 712
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004703 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238018 predicted 587
2 SASI_Mm01_00238019 predicted 832
3 SASI_Mm01_00238020 predicted 715
4 SASI_Mm01_00238021 predicted 690
5 SASI_Mm01_00238022 predicted 844
6 SASI_Mm01_00238023 predicted 586
7 SASI_Mm01_00238024 predicted 768
8 SASI_Mm01_00238025 predicted 616
9 SASI_Mm01_00238026 predicted 590
10 SASI_Mm01_00238027 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001004705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245519 predicted 312
2 SASI_Mm01_00245520 predicted 284
3 SASI_Mm01_00245521 predicted 255
4 SASI_Mm01_00245522 predicted 608
5 SASI_Mm01_00245523 predicted 299
6 SASI_Mm01_00245524 predicted 239
7 SASI_Mm01_00245525 predicted 381
8 SASI_Mm01_00245526 predicted 467
9 SASI_Mm01_00245527 predicted 510
10 SASI_Mm01_00245528 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098789
NDUFA4L2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-147s21c1
Sequence:CCGGGACTCTACTTGCTGCGACTTGCTCGAGCAAGTCGCAGCAAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-229s21c1
Sequence:CCGGGAGTCCCAATGACCAGTACAACTCGAGTTGTACTGGTCATTGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098789.1-309s21c1
Sequence:CCGGTCAGAGATCTCCACGTAAATCCTCGAGGATTTACGTGGAGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-255s21c1
Sequence:CCGGTTGCCGTTTCAACCGACTACACTCGAGTGTAGTCGGTTGAAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-96s21c1
Sequence:CCGGCTGGGCTCATCCCAATGATTGCTCGAGCAATCATTGGGATGAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098789
NDUFA4L2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-147s21c1
Sequence:CCGGGACTCTACTTGCTGCGACTTGCTCGAGCAAGTCGCAGCAAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-229s21c1
Sequence:CCGGGAGTCCCAATGACCAGTACAACTCGAGTTGTACTGGTCATTGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098789.1-309s21c1
Sequence:CCGGTCAGAGATCTCCACGTAAATCCTCGAGGATTTACGTGGAGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-255s21c1
Sequence:CCGGTTGCCGTTTCAACCGACTACACTCGAGTGTAGTCGGTTGAAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-96s21c1
Sequence:CCGGCTGGGCTCATCCCAATGATTGCTCGAGCAATCATTGGGATGAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098789
NDUFA4L2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-147s21c1
Sequence:CCGGGACTCTACTTGCTGCGACTTGCTCGAGCAAGTCGCAGCAAGTAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-229s21c1
Sequence:CCGGGAGTCCCAATGACCAGTACAACTCGAGTTGTACTGGTCATTGGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098789.1-309s21c1
Sequence:CCGGTCAGAGATCTCCACGTAAATCCTCGAGGATTTACGTGGAGATCTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-255s21c1
Sequence:CCGGTTGCCGTTTCAACCGACTACACTCGAGTGTAGTCGGTTGAAACGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098789.1-96s21c1
Sequence:CCGGCTGGGCTCATCCCAATGATTGCTCGAGCAATCATTGGGATGAGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020142
NDUFA4L2 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-408s1c1
Sequence:CCGGCTGCTGGGACAGAAAGAACAACTCGAGTTGTTCTTTCTGTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020142.3-861s1c1
Sequence:CCGGGCCTACGTGAGCCAACAAGAACTCGAGTTCTTGTTGGCTCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-485s1c1
Sequence:CCGGCCACTGACTATAAGAAGCTGACTCGAGTCAGCTTCTTATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-324s1c1
Sequence:CCGGCATCCCGATGATCGGCTTAATCTCGAGATTAAGCCGATCATCGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-474s1c1
Sequence:CCGGCCTTGCAGTTTCCACTGACTACTCGAGTAGTCAGTGGAAACTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020142
NDUFA4L2 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-408s1c1
Sequence:CCGGCTGCTGGGACAGAAAGAACAACTCGAGTTGTTCTTTCTGTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020142.3-861s1c1
Sequence:CCGGGCCTACGTGAGCCAACAAGAACTCGAGTTCTTGTTGGCTCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-485s1c1
Sequence:CCGGCCACTGACTATAAGAAGCTGACTCGAGTCAGCTTCTTATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-324s1c1
Sequence:CCGGCATCCCGATGATCGGCTTAATCTCGAGATTAAGCCGATCATCGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-474s1c1
Sequence:CCGGCCTTGCAGTTTCCACTGACTACTCGAGTAGTCAGTGGAAACTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020142
NDUFA4L2 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-408s1c1
Sequence:CCGGCTGCTGGGACAGAAAGAACAACTCGAGTTGTTCTTTCTGTCCCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020142.3-861s1c1
Sequence:CCGGGCCTACGTGAGCCAACAAGAACTCGAGTTCTTGTTGGCTCACGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-485s1c1
Sequence:CCGGCCACTGACTATAAGAAGCTGACTCGAGTCAGCTTCTTATAGTCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-324s1c1
Sequence:CCGGCATCCCGATGATCGGCTTAATCTCGAGATTAAGCCGATCATCGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020142.3-474s1c1
Sequence:CCGGCCTTGCAGTTTCCACTGACTACTCGAGTAGTCAGTGGAAACTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks