EMAIL THIS PAGE TO A FRIEND

NDUFAB1

NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa

Synonyms: ACP FASN2A SDAP
UniProtKB ID: O14561, B2R4M1, Q9UNV1
Gene ID:
Mouse(70316) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1
Rat(293453) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1
chicken(416571) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
dog(479805) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
cow(327702) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
domestic cat(101099010) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
domestic guinea pig(100721191) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
naked mole-rat(101719526) NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028177 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028177 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028177 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005003 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005003 Rosetta Predictions human pricing
NM_001106294 Rosetta Predictions rat pricing
NM_028177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063203 predicted 230
2 SASI_Hs01_00063205 predicted 311
3 SASI_Hs01_00063206 predicted 265
4 SASI_Hs01_00063208 predicted 206
5 SASI_Hs01_00063209 predicted 242
6 SASI_Hs01_00063210 predicted 256
7 SASI_Hs01_00063211 predicted 345
8 SASI_Hs02_00338751 predicted 268
9 SASI_Hs02_00338752 predicted 229
10 SASI_Hs02_00338753 predicted 314
11 SASI_Hs01_00063204 predicted 266
12 SASI_Hs01_00063207 predicted 288
13 SASI_Hs01_00063212 predicted 197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106294 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217558 predicted 392
2 SASI_Rn02_00217559 predicted 475
3 SASI_Rn02_00217560 predicted 584
4 SASI_Rn02_00217561 predicted 472
5 SASI_Rn02_00217562 predicted 284
6 SASI_Rn02_00217563 predicted 472
7 SASI_Rn02_00217564 predicted 504
8 SASI_Rn02_00217565 predicted 208
9 SASI_Rn02_00217566 predicted 390
10 SASI_Rn02_00217567 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108828 predicted 254
2 SASI_Mm02_00333442 predicted 202
3 SASI_Mm01_00108822 predicted 242
4 SASI_Mm02_00333443 predicted 259
5 SASI_Mm01_00108823 predicted 210
6 SASI_Mm01_00108824 predicted 511
7 SASI_Mm01_00108825 predicted 523
8 SASI_Mm01_00108826 predicted 279
9 SASI_Mm01_00108827 predicted 391
10 SASI_Mm01_00108829 predicted 478
11 SASI_Mm01_00108830 predicted 424
12 SASI_Mm01_00108831 predicted 474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028177
VALIDATED
NDUFAB1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-579s21c1
Sequence:CCGGGTGGCTGCTGACTGGAACTTACTCGAGTAAGTTCCAGTCAGCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028177.3-492s21c1
Sequence:CCGGGAATAAAGTATCAGATGTCTTCTCGAGAAGACATCTGATACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-537s21c1
Sequence:CCGGTACTACACACTGACAACCAAGCTCGAGCTTGGTTGTCAGTGTGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028177.2-641s1c1
Sequence:CCGGGCTACTTTAAATCCCAGGGTACTCGAGTACCCTGGGATTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-362s1c1
Sequence:CCGGGTTTGGACCAAGTGGAAATTACTCGAGTAATTTCCACTTGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-243s1c1
Sequence:CCGGCCCACTGACGTTAGACGGAATCTCGAGATTCCGTCTAACGTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-318s1c1
Sequence:CCGGGCTCTCCGTAAATTCTCATTTCTCGAGAAATGAGAATTTACGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-472s1c1
Sequence:CCGGGCAGATAAGAAGGATGTGTATCTCGAGATACACATCCTTCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028177
VALIDATED
NDUFAB1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-579s21c1
Sequence:CCGGGTGGCTGCTGACTGGAACTTACTCGAGTAAGTTCCAGTCAGCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028177.3-492s21c1
Sequence:CCGGGAATAAAGTATCAGATGTCTTCTCGAGAAGACATCTGATACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-537s21c1
Sequence:CCGGTACTACACACTGACAACCAAGCTCGAGCTTGGTTGTCAGTGTGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028177.2-641s1c1
Sequence:CCGGGCTACTTTAAATCCCAGGGTACTCGAGTACCCTGGGATTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-362s1c1
Sequence:CCGGGTTTGGACCAAGTGGAAATTACTCGAGTAATTTCCACTTGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-243s1c1
Sequence:CCGGCCCACTGACGTTAGACGGAATCTCGAGATTCCGTCTAACGTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-318s1c1
Sequence:CCGGGCTCTCCGTAAATTCTCATTTCTCGAGAAATGAGAATTTACGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-472s1c1
Sequence:CCGGGCAGATAAGAAGGATGTGTATCTCGAGATACACATCCTTCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028177
VALIDATED
NDUFAB1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431301    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-579s21c1
Sequence:CCGGGTGGCTGCTGACTGGAACTTACTCGAGTAAGTTCCAGTCAGCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028177.3-492s21c1
Sequence:CCGGGAATAAAGTATCAGATGTCTTCTCGAGAAGACATCTGATACTTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424434    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028177.3-537s21c1
Sequence:CCGGTACTACACACTGACAACCAAGCTCGAGCTTGGTTGTCAGTGTGTAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028177.2-641s1c1
Sequence:CCGGGCTACTTTAAATCCCAGGGTACTCGAGTACCCTGGGATTTAAAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-362s1c1
Sequence:CCGGGTTTGGACCAAGTGGAAATTACTCGAGTAATTTCCACTTGGTCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028177.2-243s1c1
Sequence:CCGGCCCACTGACGTTAGACGGAATCTCGAGATTCCGTCTAACGTCAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-318s1c1
Sequence:CCGGGCTCTCCGTAAATTCTCATTTCTCGAGAAATGAGAATTTACGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028177.2-472s1c1
Sequence:CCGGGCAGATAAGAAGGATGTGTATCTCGAGATACACATCCTTCTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005003
VALIDATED
NDUFAB1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-447s1c1
Sequence:CCGGGTCCACAAGAAATTGTAGATTCTCGAGAATCTACAATTTCTTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-192s1c1
Sequence:CCGGCGCAGGTTCCTGGTAGAGTTACTCGAGTAACTCTACCAGGAACCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-271s1c1
Sequence:CCGGCCGTGTTCTTTACGTATTGAACTCGAGTTCAATACGTAAAGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005003.2-377s1c1
Sequence:CCGGGAGATTATCATGGCCATGGAACTCGAGTTCCATGGCCATGATAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-472s1c1
Sequence:CCGGTGCAGATAAGAAGGATGTATACTCGAGTATACATCCTTCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005003
VALIDATED
NDUFAB1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-447s1c1
Sequence:CCGGGTCCACAAGAAATTGTAGATTCTCGAGAATCTACAATTTCTTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-192s1c1
Sequence:CCGGCGCAGGTTCCTGGTAGAGTTACTCGAGTAACTCTACCAGGAACCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-271s1c1
Sequence:CCGGCCGTGTTCTTTACGTATTGAACTCGAGTTCAATACGTAAAGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005003.2-377s1c1
Sequence:CCGGGAGATTATCATGGCCATGGAACTCGAGTTCCATGGCCATGATAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-472s1c1
Sequence:CCGGTGCAGATAAGAAGGATGTATACTCGAGTATACATCCTTCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005003
VALIDATED
NDUFAB1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-447s1c1
Sequence:CCGGGTCCACAAGAAATTGTAGATTCTCGAGAATCTACAATTTCTTGTGGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-192s1c1
Sequence:CCGGCGCAGGTTCCTGGTAGAGTTACTCGAGTAACTCTACCAGGAACCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-271s1c1
Sequence:CCGGCCGTGTTCTTTACGTATTGAACTCGAGTTCAATACGTAAAGAACACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005003.2-377s1c1
Sequence:CCGGGAGATTATCATGGCCATGGAACTCGAGTTCCATGGCCATGATAATCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005003.2-472s1c1
Sequence:CCGGTGCAGATAAGAAGGATGTATACTCGAGTATACATCCTTCTTATCTGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks