EMAIL THIS PAGE TO A FRIEND

NDUFB4

NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa

Synonyms: B15 CI-B15
UniProtKB ID: O95168, B2RUY3, B9EJC7
Gene ID:
Human(4710) Summary: This gene encodes a non-catalytic subunit of the multisubunit NADH:ubiquinone oxidoreductase, the first enzyme complex in the mitochondrial electron transport chain (complex I). Mammalian complex I is composed of 45 different subunits and transfers electrons from NADH to ubiquinone. [provided by RefSeq, Dec 2009]
Mouse(68194) NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
Rat(288088) NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4
Zebrafish(406306) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4
dog(478577) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
cow(327706) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
domestic cat(101089135) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
chicken(769954) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
domestic guinea pig(100715407) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
naked mole-rat(101696660) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
sheep(101108353) NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004547 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003971 MISSION® esiRNA esiRNA targeting mouse Ndufb4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004547 Rosetta Predictions human pricing
NM_001037338 Rosetta Predictions rat pricing
NM_026610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337858 predicted 262
2 SASI_Hs01_00225667 predicted 276
3 SASI_Hs01_00225668 predicted 282
4 SASI_Hs01_00225669 predicted 238
5 SASI_Hs01_00225670 predicted 239
6 SASI_Hs01_00225671 predicted 197
7 SASI_Hs01_00225672 predicted 302
8 SASI_Hs01_00225674 predicted 272
9 SASI_Hs02_00337859 predicted 276
10 SASI_Hs02_00337860 predicted 269
11 SASI_Hs01_00225665 predicted 302
12 SASI_Hs01_00225666 predicted 283
13 SASI_Hs01_00225673 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037338 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098018 predicted 194
2 SASI_Rn01_00098019 predicted 196
3 SASI_Rn01_00098020 predicted 229
4 SASI_Rn01_00098021 predicted 226
5 SASI_Rn01_00098023 predicted 218
6 SASI_Rn01_00098024 predicted 226
7 SASI_Rn01_00098025 predicted 214
8 SASI_Rn01_00098026 predicted 196
9 SASI_Rn01_00098027 predicted 226
10 SASI_Rn02_00204370 predicted 229
11 SASI_Rn01_00098022 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108039 predicted 206
2 SASI_Mm01_00108032 predicted 212
3 SASI_Mm01_00108040 predicted 216
4 SASI_Mm01_00108033 predicted 194
5 SASI_Mm01_00108041 predicted 223
6 SASI_Mm02_00330570 predicted 221
7 SASI_Mm01_00108034 predicted 222
8 SASI_Mm02_00330571 predicted 217
9 SASI_Mm01_00108035 predicted 209
10 SASI_Mm02_00330572 predicted 208
11 SASI_Mm01_00108036 predicted 218
12 SASI_Mm01_00108037 predicted 212
13 SASI_Mm01_00108038 predicted 212
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026610
VALIDATED
NDUFB4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-107s21c1
Sequence:CCGGAGGTCGAGCGCTTGAGCATAACTCGAGTTATGCTCAAGCGCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-336s21c1
Sequence:CCGGGGACAGAAAGGAAAGACTTATCTCGAGATAAGTCTTTCCTTTCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-215s1c1
Sequence:CCGGCCTATGCAAGATCAGCAAATACTCGAGTATTTGCTGATCTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-141s1c1
Sequence:CCGGACGGGAGTATCTGCTTCAGTACTCGAGTACTGAAGCAGATACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-199s1c1
Sequence:CCGGGCCTTGATTCGCTGGACCTATCTCGAGATAGGTCCAGCGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-300s1c1
Sequence:CCGGCCTCATCTTCTGGTATTATGTCTCGAGACATAATACCAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-254s1c1
Sequence:CCGGCCACTCCCAAGAACTCACTTTCTCGAGAAAGTGAGTTCTTGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026610
VALIDATED
NDUFB4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-107s21c1
Sequence:CCGGAGGTCGAGCGCTTGAGCATAACTCGAGTTATGCTCAAGCGCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-336s21c1
Sequence:CCGGGGACAGAAAGGAAAGACTTATCTCGAGATAAGTCTTTCCTTTCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-215s1c1
Sequence:CCGGCCTATGCAAGATCAGCAAATACTCGAGTATTTGCTGATCTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-141s1c1
Sequence:CCGGACGGGAGTATCTGCTTCAGTACTCGAGTACTGAAGCAGATACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-199s1c1
Sequence:CCGGGCCTTGATTCGCTGGACCTATCTCGAGATAGGTCCAGCGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-300s1c1
Sequence:CCGGCCTCATCTTCTGGTATTATGTCTCGAGACATAATACCAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-254s1c1
Sequence:CCGGCCACTCCCAAGAACTCACTTTCTCGAGAAAGTGAGTTCTTGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026610
VALIDATED
NDUFB4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-107s21c1
Sequence:CCGGAGGTCGAGCGCTTGAGCATAACTCGAGTTATGCTCAAGCGCTCGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026610.1-336s21c1
Sequence:CCGGGGACAGAAAGGAAAGACTTATCTCGAGATAAGTCTTTCCTTTCTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-215s1c1
Sequence:CCGGCCTATGCAAGATCAGCAAATACTCGAGTATTTGCTGATCTTGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-141s1c1
Sequence:CCGGACGGGAGTATCTGCTTCAGTACTCGAGTACTGAAGCAGATACTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-199s1c1
Sequence:CCGGGCCTTGATTCGCTGGACCTATCTCGAGATAGGTCCAGCGAATCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-300s1c1
Sequence:CCGGCCTCATCTTCTGGTATTATGTCTCGAGACATAATACCAGAAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_026610.1-254s1c1
Sequence:CCGGCCACTCCCAAGAACTCACTTTCTCGAGAAAGTGAGTTCTTGGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004547
VALIDATED
NDUFB4 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-206s1c1
Sequence:CCGGCTGAAACGAGAGTACCTGCTTCTCGAGAAGCAGGTACTCTCGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004547.4-143s1c1
Sequence:CCGGGAATACAACATATCTCCGGAACTCGAGTTCCGGAGATATGTTGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-223s1c1
Sequence:CCGGGCTTCAGTACAACGATCCCAACTCGAGTTGGGATCGTTGTACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-137s1c1
Sequence:CCGGCCAGCCGAATACAACATATCTCTCGAGAGATATGTTGTATTCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-284s1c1
Sequence:CCGGGCCTATGCAAGAACAATAAATCTCGAGATTTATTGTTCTTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004547
VALIDATED
NDUFB4 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-206s1c1
Sequence:CCGGCTGAAACGAGAGTACCTGCTTCTCGAGAAGCAGGTACTCTCGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004547.4-143s1c1
Sequence:CCGGGAATACAACATATCTCCGGAACTCGAGTTCCGGAGATATGTTGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-223s1c1
Sequence:CCGGGCTTCAGTACAACGATCCCAACTCGAGTTGGGATCGTTGTACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-137s1c1
Sequence:CCGGCCAGCCGAATACAACATATCTCTCGAGAGATATGTTGTATTCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-284s1c1
Sequence:CCGGGCCTATGCAAGAACAATAAATCTCGAGATTTATTGTTCTTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004547
VALIDATED
NDUFB4 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-206s1c1
Sequence:CCGGCTGAAACGAGAGTACCTGCTTCTCGAGAAGCAGGTACTCTCGTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004547.4-143s1c1
Sequence:CCGGGAATACAACATATCTCCGGAACTCGAGTTCCGGAGATATGTTGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-223s1c1
Sequence:CCGGGCTTCAGTACAACGATCCCAACTCGAGTTGGGATCGTTGTACTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-137s1c1
Sequence:CCGGCCAGCCGAATACAACATATCTCTCGAGAGATATGTTGTATTCGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004547.4-284s1c1
Sequence:CCGGGCCTATGCAAGAACAATAAATCTCGAGATTTATTGTTCTTGCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks