EMAIL THIS PAGE TO A FRIEND

NDUFS1

NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)

Synonyms: CI-75Kd CI-75k PRO1304
Gene ID:
Human(4719) Summary: The protein encoded by this gene belongs to the complex I 75 kDa subunit family. Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. This protein is the largest subunit of complex I and it is a component of the iron-sulfur (IP) fragment of the enzyme. It may form part of the active site crevice where NADH is oxidized. Mutations in this gene are associated with complex I deficiency. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
Mouse(227197) NADH dehydrogenase (ubiquinone) Fe-S protein 1
Rat(301458) NADH dehydrogenase (ubiquinone) Fe-S protein 1
Zebrafish(493605) NADH dehydrogenase (ubiquinone) Fe-S protein 1
cow(288380) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Horse(100066330) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
domestic cat(101100747) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
dog(478880) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
chicken(424102) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Goat(100861376) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
sheep(101115434) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
naked mole-rat(101698993) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100726311) NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005006 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145518 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145518 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145518 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005006 Rosetta Predictions human pricing
NM_001005550 Rosetta Predictions rat pricing
NM_145518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013900 predicted 1314
2 SASI_Hs01_00013901 predicted 1797
3 SASI_Hs01_00013902 predicted 557
4 SASI_Hs01_00013903 predicted 2013
5 SASI_Hs01_00013904 predicted 737
6 SASI_Hs02_00338760 predicted 1931
7 SASI_Hs01_00013906 predicted 1555
8 SASI_Hs01_00013908 predicted 1628
9 SASI_Hs01_00013909 predicted 629
10 SASI_Hs02_00338761 predicted 1499
11 SASI_Hs01_00013905 predicted 976
12 SASI_Hs01_00013907 predicted 1185
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059345 predicted 1113
2 SASI_Rn01_00059346 predicted 1743
3 SASI_Rn01_00059347 predicted 1411
4 SASI_Rn01_00059348 predicted 754
5 SASI_Rn02_00198409 predicted 2138
6 SASI_Rn01_00059350 predicted 2235
7 SASI_Rn02_00198410 predicted 1425
8 SASI_Rn02_00198411 predicted 2028
9 SASI_Rn02_00198412 predicted 2214
10 SASI_Rn01_00059353 predicted 670
11 SASI_Rn01_00059344 predicted 1199
12 SASI_Rn01_00059349 predicted 571
13 SASI_Rn01_00059351 predicted 1242
14 SASI_Rn01_00059352 predicted 1603
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046057 predicted 1262
2 SASI_Mm01_00046058 predicted 1805
3 SASI_Mm01_00046059 predicted 735
4 SASI_Mm01_00046060 predicted 970
5 SASI_Mm01_00046061 predicted 1455
6 SASI_Mm01_00046062 predicted 2138
7 SASI_Mm01_00046063 predicted 1778
8 SASI_Mm01_00046064 predicted 1660
9 SASI_Mm02_00340991 predicted 637
10 SASI_Mm01_00046065 predicted 657
11 SASI_Mm01_00046066 predicted 2023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005006
VALIDATED
NDUFS1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-809s21c1
Sequence:CCGGGTAGGTGCCCTAACCTCTAAGCTCGAGCTTAGAGGTTAGGGCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005006.5-2551s21c1
Sequence:CCGGTAACCTTTGTGACGAACATAACTCGAGTTATGTTCGTCACAAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2285s21c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-410s21c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2182s21c1
Sequence:CCGGTCCACCTCAGCTAACTATAAACTCGAGTTTATAGTTAGCTGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005006.5-1361s1c1
Sequence:CCGGCCACTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-2285s1c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-1260s1c1
Sequence:CCGGGCACAGATTTGCGTTCCAATTCTCGAGAATTGGAACGCAAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-555s1c1
Sequence:CCGGCCATGATGTTTGGAAATGATACTCGAGTATCATTTCCAAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-410s1c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005006
VALIDATED
NDUFS1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-809s21c1
Sequence:CCGGGTAGGTGCCCTAACCTCTAAGCTCGAGCTTAGAGGTTAGGGCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005006.5-2551s21c1
Sequence:CCGGTAACCTTTGTGACGAACATAACTCGAGTTATGTTCGTCACAAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2285s21c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-410s21c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2182s21c1
Sequence:CCGGTCCACCTCAGCTAACTATAAACTCGAGTTTATAGTTAGCTGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005006.5-1361s1c1
Sequence:CCGGCCACTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-2285s1c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-1260s1c1
Sequence:CCGGGCACAGATTTGCGTTCCAATTCTCGAGAATTGGAACGCAAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-555s1c1
Sequence:CCGGCCATGATGTTTGGAAATGATACTCGAGTATCATTTCCAAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-410s1c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005006
VALIDATED
NDUFS1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-809s21c1
Sequence:CCGGGTAGGTGCCCTAACCTCTAAGCTCGAGCTTAGAGGTTAGGGCACCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005006.5-2551s21c1
Sequence:CCGGTAACCTTTGTGACGAACATAACTCGAGTTATGTTCGTCACAAAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2285s21c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-410s21c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005006.5-2182s21c1
Sequence:CCGGTCCACCTCAGCTAACTATAAACTCGAGTTTATAGTTAGCTGAGGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005006.5-1361s1c1
Sequence:CCGGCCACTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-2285s1c1
Sequence:CCGGGCAGTAGAGGAACCATCCATACTCGAGTATGGATGGTTCCTCTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-1260s1c1
Sequence:CCGGGCACAGATTTGCGTTCCAATTCTCGAGAATTGGAACGCAAATCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_005006.5-555s1c1
Sequence:CCGGCCATGATGTTTGGAAATGATACTCGAGTATCATTTCCAAACATCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005006.5-410s1c1
Sequence:CCGGCCAGTAATGAAGGGTTGGAATCTCGAGATTCCAACCCTTCATTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145518
VALIDATED
NDUFS1 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1363s21c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-412s21c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-685s21c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1651s21c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-2017s21c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1651s1c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1363s1c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145518.1-685s1c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-2017s1c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-412s1c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145518
VALIDATED
NDUFS1 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1363s21c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-412s21c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-685s21c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1651s21c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-2017s21c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1651s1c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1363s1c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145518.1-685s1c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-2017s1c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-412s1c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145518
VALIDATED
NDUFS1 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1363s21c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-412s21c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-685s21c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-1651s21c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145518.1-2017s21c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1651s1c1
Sequence:CCGGGCAGAGTGGAAAGTTATGAATCTCGAGATTCATAACTTTCCACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-1363s1c1
Sequence:CCGGCCGCTGTTTAATGCTAGAATTCTCGAGAATTCTAGCATTAAACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145518.1-685s1c1
Sequence:CCGGGCAAGTGAGATTGCAGGAGTACTCGAGTACTCCTGCAATCTCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-2017s1c1
Sequence:CCGGGCAGGTATCACTCTTCCATATCTCGAGATATGGAAGAGTGATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145518.1-412s1c1
Sequence:CCGGCCTGTAATGAAGGGCTGGAATCTCGAGATTCCAGCCCTTCATTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks