EMAIL THIS PAGE TO A FRIEND

NDUFS8

NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)

Synonyms: CI-23k CI23KD TYKY
UniProtKB ID: O00217, B2RB86, Q0VDA8
Gene ID:
Human(4728) Summary: This gene encodes a subunit of mitochondrial NADH:ubiquinone oxidoreductase, or Complex I, a multimeric enzyme of the respiratory chain responsible for NADH oxidation, ubiquinone reduction, and the ejection of protons from mitochondria. The encoded protein is involved in the binding of two of the six to eight iron-sulfur clusters of Complex I and, as such, is required in the electron transfer process. Mutations in this gene have been associated with Leigh syndrome. [provided by RefSeq, Mar 2010]
Mouse(225887) NADH dehydrogenase (ubiquinone) Fe-S protein 8
Rat(293652) NADH dehydrogenase (ubiquinone) Fe-S protein 8
chicken(769492) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
cow(287027) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
domestic cat(101094451) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
dog(610413) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
domestic guinea pig(100727207) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
naked mole-rat(101721961) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
sheep(101112935) NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002496 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002496 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002496 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002496 Rosetta Predictions human pricing
NM_001106322 Rosetta Predictions rat pricing
NM_144870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002496 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333951 predicted 204
2 SASI_Hs01_00054902 predicted 246
3 SASI_Hs01_00054903 predicted 341
4 SASI_Hs02_00333952 predicted 199
5 SASI_Hs01_00054904 predicted 234
6 SASI_Hs01_00054905 predicted 238
7 SASI_Hs01_00054906 predicted 308
8 SASI_Hs01_00054907 predicted 531
9 SASI_Hs02_00333953 predicted 204
10 SASI_Hs01_00054908 predicted 226
11 SASI_Hs01_00054909 predicted 227
12 SASI_Hs01_00054910 predicted 478
13 SASI_Hs01_00054911 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106322 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217828 predicted 198
2 SASI_Rn02_00217829 predicted 456
3 SASI_Rn02_00217830 predicted 453
4 SASI_Rn02_00217831 predicted 522
5 SASI_Rn02_00217832 predicted 452
6 SASI_Rn02_00217833 predicted 210
7 SASI_Rn02_00217834 predicted 424
8 SASI_Rn02_00217835 predicted 245
9 SASI_Rn02_00217836 predicted 465
10 SASI_Rn02_00217837 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134668 predicted 672
2 SASI_Mm02_00340309 predicted 306
3 SASI_Mm02_00340310 predicted 302
4 SASI_Mm02_00340311 predicted 346
5 SASI_Mm02_00340312 predicted 344
6 SASI_Mm02_00340313 predicted 383
7 SASI_Mm02_00340314 predicted 342
8 SASI_Mm02_00340315 predicted 318
9 SASI_Mm01_00134673 predicted 663
10 SASI_Mm01_00134675 predicted 464
11 SASI_Mm01_00134669 predicted 477
12 SASI_Mm01_00134670 predicted 265
13 SASI_Mm01_00134671 predicted 228
14 SASI_Mm01_00134672 predicted 219
15 SASI_Mm01_00134674 predicted 527
16 SASI_Mm01_00134676 predicted 324
17 SASI_Mm01_00134677 predicted 394
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144870
VALIDATED
NDUFS8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-151s1c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-226s1c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-492s1c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-606s1c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-107s1c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-307s21c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-426s21c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-351s21c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-692s21c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-806s21c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144870
VALIDATED
NDUFS8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-151s1c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-226s1c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-492s1c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-606s1c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-107s1c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-307s21c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-426s21c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-351s21c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-692s21c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-806s21c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144870
VALIDATED
NDUFS8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-151s1c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-226s1c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-492s1c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-606s1c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144870.2-107s1c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-307s21c1
Sequence:CCGGCAGGACATCTTAATGGACAAACTCGAGTTTGTCCATTAAGATGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-426s21c1
Sequence:CCGGCGGATTCTGATGTGGACAGAACTCGAGTTCTGTCCACATCAGAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324501    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-351s21c1
Sequence:CCGGGCAACGTACAAGTATGTGAATCTCGAGATTCACATACTTGTACGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-692s21c1
Sequence:CCGGCGACATGACCAAGTGTATCTACTCGAGTAGATACACTTGGTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144870.4-806s21c1
Sequence:CCGGCAACAAGGAGAAGCTACTCAACTCGAGTTGAGTAGCTTCTCCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002496
VALIDATED
NDUFS8 MISSION shRNA Bacterial Glycerol Stock
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-599s1c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-335s1c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-524s1c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-194s1c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-419s1c1
Sequence:CCGGGCGTTGCATTGCCTGCAAGCTCTCGAGAGCTTGCAGGCAATGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002496.2-539s21c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-614s21c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-209s21c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-350s21c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002496
VALIDATED
NDUFS8 MISSION shRNA shRNA Plasmid DNA
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-599s1c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-335s1c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-524s1c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-194s1c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-419s1c1
Sequence:CCGGGCGTTGCATTGCCTGCAAGCTCTCGAGAGCTTGCAGGCAATGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002496.2-539s21c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-614s21c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-209s21c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-350s21c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002496
VALIDATED
NDUFS8 MISSION shRNA Lentiviral Transduction Particles
NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-599s1c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-335s1c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-524s1c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002496.1-194s1c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_002496.1-419s1c1
Sequence:CCGGGCGTTGCATTGCCTGCAAGCTCTCGAGAGCTTGCAGGCAATGCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002496.2-539s21c1
Sequence:CCGGCATCGACATGACCAAGTGCATCTCGAGATGCACTTGGTCATGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-614s21c1
Sequence:CCGGCAACTTTGAGTTCTCCACGGACTCGAGTCCGTGGAGAACTCAAAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-209s21c1
Sequence:CCGGCACCTACAAGTATGTGAACATCTCGAGATGTTCACATACTTGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_002496.2-350s21c1
Sequence:CCGGCATCAACTACCCGTTCGAGAACTCGAGTTCTCGAACGGGTAGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks