EMAIL THIS PAGE TO A FRIEND

NEFM

neurofilament, medium polypeptide

Synonyms: NEF3 NF-M NFM
UniProtKB ID: P07197, B4DGN2, E9PBF7, Q4QRK6
Gene ID:
Human(4741) Summary: Neurofilaments are type IV intermediate filament heteropolymers composed of light, medium, and heavy chains. Neurofilaments comprise the axoskeleton and functionally maintain neuronal caliber. They may also play a role in intracellular transport to axons and dendrites. This gene encodes the medium neurofilament protein. This protein is commonly used as a biomarker of neuronal damage. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Oct 2008]
Mouse(18040) neurofilament, medium polypeptide
Rat(24588) neurofilament, medium polypeptide
chicken(396206) neurofilament, medium polypeptide
cow(281347) neurofilament, medium polypeptide
domestic cat(101081291) neurofilament, medium polypeptide
dog(486111) neurofilament, medium polypeptide
sheep(101112452) neurofilament, medium polypeptide
domestic guinea pig(100731522) neurofilament, medium polypeptide
naked mole-rat(101703965) neurofilament, medium polypeptide
Domestic Rabbit(100009343) neurofilament, medium polypeptide
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501318 Anti-NEFM antibody produced in goat affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, western blot pricing
HPA022845 Anti-NEFM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab1 human
immunohistochemistry, western blot pricing
HPA023138 Anti-NEFM antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
AMAB91027 Monoclonal Anti-NEFM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2678, purified immunoglobulin, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
AMAB91028 Monoclonal Anti-NEFM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2688, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
AMAB91029 Monoclonal Anti-NEFM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2697, purified immunoglobulin, buffered aqueous glycerol solution mouse, rat, human
immunohistochemistry, western blot pricing
AMAB91030 Monoclonal Anti-NEFM antibody produced in mouse Prestige Antibodies® Powered by Atlas Antibodies, clone CL2705, purified immunoglobulin, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
N2787 Monoclonal Anti-Neurofilament 160 antibody produced in mouse ~2 mg/mL, clone RMO44, purified immunoglobulin, buffered aqueous solution zebrafish, mouse, rat, human
immunohistochemistry, microarray, western blot pricing
N5264 Monoclonal Anti-Neurofilament 160 antibody produced in mouse clone NN18, ascites fluid pig, human
immunohistochemistry, western blot pricing
N2912 Monoclonal Anti-Neurofilament 160/200 antibody produced in mouse ~2 mg/mL, clone RMdO20, purified immunoglobulin, buffered aqueous solution rat, mouse, human
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
SAB4700772 Monoclonal Anti-Neurofilament medium protein antibody produced in mouse clone NF-09, purified immunoglobulin, buffered aqueous solution mammals
immunocytochemistry, immunohistochemistry, western blot pricing
G9670 Monoclonal Anti-O-Glycosylated Neurofilament-M antibody produced in mouse ~2 mg/mL, clone NL6, purified immunoglobulin, buffered aqueous solution rat, human
immunocytochemistry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005382 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026511 MISSION® esiRNA esiRNA human NEF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105541 Rosetta Predictions human pricing
NM_005382 Rosetta Predictions human pricing
NM_017029 Rosetta Predictions rat pricing
NM_008691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105541 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324301 predicted 2289
2 SASI_Hs02_00324302 predicted 2218
3 SASI_Hs02_00324303 predicted 1986
4 SASI_Hs02_00324304 predicted 2003
5 SASI_Hs02_00324305 predicted 2009
6 SASI_Hs02_00324306 predicted 1978
7 SASI_Hs02_00324307 predicted 2048
8 SASI_Hs02_00324308 predicted 2219
9 SASI_Hs02_00324309 predicted 2069
10 SASI_Hs02_00324310 predicted 2232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339492 predicted 3042
2 SASI_Hs01_00088535 predicted 2968
3 SASI_Hs02_00339493 predicted 2734
4 SASI_Hs02_00339494 predicted 2766
5 SASI_Hs02_00339495 predicted 2761
6 SASI_Hs01_00088538 predicted 2734
7 SASI_Hs02_00339496 predicted 2808
8 SASI_Hs02_00339497 predicted 2978
9 SASI_Hs02_00339498 predicted 2831
10 SASI_Hs02_00339499 predicted 2990
11 SASI_Hs01_00088534 predicted 335
12 SASI_Hs01_00088536 predicted 2958
13 SASI_Hs01_00088537 predicted 942
14 SASI_Hs01_00088539 predicted 978
15 SASI_Hs01_00088540 predicted 1191
16 SASI_Hs01_00088541 predicted 3013
17 SASI_Hs01_00088542 predicted 1223
18 SASI_Hs01_00088543 predicted 3000
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068949 predicted 2535
2 SASI_Rn01_00068950 predicted 1317
3 SASI_Rn01_00068951 predicted 784
4 SASI_Rn01_00068952 predicted 1235
5 SASI_Rn02_00261205 predicted 821
6 SASI_Rn01_00068953 predicted 381
7 SASI_Rn01_00068954 predicted 650
8 SASI_Rn01_00068956 predicted 2593
9 SASI_Rn01_00068957 predicted 967
10 SASI_Rn01_00068958 predicted 1175
11 SASI_Rn01_00068955 predicted 2630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00314494 predicted 2929
2 SASI_Mm02_00314495 predicted 806
3 SASI_Mm02_00314496 predicted 2697
4 SASI_Mm01_00169707 predicted 1468
5 SASI_Mm02_00314497 predicted 934
6 SASI_Mm02_00314498 predicted 529
7 SASI_Mm02_00314499 predicted 2783
8 SASI_Mm02_00314500 predicted 1400
9 SASI_Mm02_00314501 predicted 525
10 SASI_Mm02_00314502 predicted 1326
11 SASI_Mm01_00169705 predicted 1289
12 SASI_Mm01_00169706 predicted 2334
13 SASI_Mm01_00169708 predicted 1184
14 SASI_Mm01_00169709 predicted 695
15 SASI_Mm01_00169710 predicted 605
16 SASI_Mm01_00169711 predicted 1040
17 SASI_Mm01_00169712 predicted 2177
18 SASI_Mm01_00169713 predicted 930
19 SASI_Mm01_00169714 predicted 1248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008691
NEFM MISSION shRNA Bacterial Glycerol Stock
neurofilament, medium polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1835s1c1
Sequence:CCGGCCGTGGAAGAAGTAAAGCCAACTCGAGTTGGCTTTACTTCTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1288s1c1
Sequence:CCGGGTCACAATATCCAGTAAGATTCTCGAGAATCTTACTGGATATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-864s1c1
Sequence:CCGGAGAGTGGTTCAAATGCCGCTACTCGAGTAGCGGCATTTGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-627s1c1
Sequence:CCGGCGAAGAGTCGTCGATGGTTAACTCGAGTTAACCATCGACGACTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-2397s1c1
Sequence:CCGGCGATGGTGCTACCAAATACATCTCGAGATGTATTTGGTAGCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-947s21c1
Sequence:CCGGCACGGTAGAGCGCAAAGATTACTCGAGTAATCTTTGCGCTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-1316s21c1
Sequence:CCGGGGCTCGTCATTTGCGAGAATACTCGAGTATTCTCGCAAATGACGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008691.2-3061s21c1
Sequence:CCGGAGCCTTAAGAAAGCTATATATCTCGAGATATATAGCTTTCTTAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008691
NEFM MISSION shRNA shRNA Plasmid DNA
neurofilament, medium polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1835s1c1
Sequence:CCGGCCGTGGAAGAAGTAAAGCCAACTCGAGTTGGCTTTACTTCTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1288s1c1
Sequence:CCGGGTCACAATATCCAGTAAGATTCTCGAGAATCTTACTGGATATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-864s1c1
Sequence:CCGGAGAGTGGTTCAAATGCCGCTACTCGAGTAGCGGCATTTGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-627s1c1
Sequence:CCGGCGAAGAGTCGTCGATGGTTAACTCGAGTTAACCATCGACGACTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-2397s1c1
Sequence:CCGGCGATGGTGCTACCAAATACATCTCGAGATGTATTTGGTAGCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-947s21c1
Sequence:CCGGCACGGTAGAGCGCAAAGATTACTCGAGTAATCTTTGCGCTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-1316s21c1
Sequence:CCGGGGCTCGTCATTTGCGAGAATACTCGAGTATTCTCGCAAATGACGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008691.2-3061s21c1
Sequence:CCGGAGCCTTAAGAAAGCTATATATCTCGAGATATATAGCTTTCTTAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008691
NEFM MISSION shRNA Lentiviral Transduction Particles
neurofilament, medium polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1835s1c1
Sequence:CCGGCCGTGGAAGAAGTAAAGCCAACTCGAGTTGGCTTTACTTCTTCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-1288s1c1
Sequence:CCGGGTCACAATATCCAGTAAGATTCTCGAGAATCTTACTGGATATTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-864s1c1
Sequence:CCGGAGAGTGGTTCAAATGCCGCTACTCGAGTAGCGGCATTTGAACCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-627s1c1
Sequence:CCGGCGAAGAGTCGTCGATGGTTAACTCGAGTTAACCATCGACGACTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008691.1-2397s1c1
Sequence:CCGGCGATGGTGCTACCAAATACATCTCGAGATGTATTTGGTAGCACCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-947s21c1
Sequence:CCGGCACGGTAGAGCGCAAAGATTACTCGAGTAATCTTTGCGCTCTACCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008691.2-1316s21c1
Sequence:CCGGGGCTCGTCATTTGCGAGAATACTCGAGTATTCTCGCAAATGACGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008691.2-3061s21c1
Sequence:CCGGAGCCTTAAGAAAGCTATATATCTCGAGATATATAGCTTTCTTAAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005382
VALIDATED
NEFM MISSION shRNA Bacterial Glycerol Stock
neurofilament, medium polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2603s1c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2965s1c1
Sequence:CCGGCGATTTCCTAAGCTGTTGGAACTCGAGTTCCAACAGCTTAGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2605s1c1
Sequence:CCGGGCTACCAAATACATCACTAAACTCGAGTTTAGTGATGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1224s1c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1225s1c1
Sequence:CCGGGAGACTAGATTTAGCACATTTCTCGAGAAATGTGCTAAATCTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2636s21c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1257s21c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1165s21c1
Sequence:CCGGGCTCGTCATTTGCGCGAATACCTCGAGGTATTCGCGCAAATGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2742s21c1
Sequence:CCGGCACTTCACACGCCATAGTAAACTCGAGTTTACTATGGCGTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005382.2-2956s21c1
Sequence:CCGGGGGATTCAAATGCATGATATTCTCGAGAATATCATGCATTTGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005382
VALIDATED
NEFM MISSION shRNA shRNA Plasmid DNA
neurofilament, medium polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2603s1c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2965s1c1
Sequence:CCGGCGATTTCCTAAGCTGTTGGAACTCGAGTTCCAACAGCTTAGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2605s1c1
Sequence:CCGGGCTACCAAATACATCACTAAACTCGAGTTTAGTGATGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1224s1c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1225s1c1
Sequence:CCGGGAGACTAGATTTAGCACATTTCTCGAGAAATGTGCTAAATCTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2636s21c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1257s21c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1165s21c1
Sequence:CCGGGCTCGTCATTTGCGCGAATACCTCGAGGTATTCGCGCAAATGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2742s21c1
Sequence:CCGGCACTTCACACGCCATAGTAAACTCGAGTTTACTATGGCGTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005382.2-2956s21c1
Sequence:CCGGGGGATTCAAATGCATGATATTCTCGAGAATATCATGCATTTGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005382
VALIDATED
NEFM MISSION shRNA Lentiviral Transduction Particles
neurofilament, medium polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2603s1c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2965s1c1
Sequence:CCGGCGATTTCCTAAGCTGTTGGAACTCGAGTTCCAACAGCTTAGGAAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-2605s1c1
Sequence:CCGGGCTACCAAATACATCACTAAACTCGAGTTTAGTGATGTATTTGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1224s1c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005382.1-1225s1c1
Sequence:CCGGGAGACTAGATTTAGCACATTTCTCGAGAAATGTGCTAAATCTAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2636s21c1
Sequence:CCGGGTGCTACCAAATACATCACTACTCGAGTAGTGATGTATTTGGTAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1257s21c1
Sequence:CCGGAGAGACTAGATTTAGCACATTCTCGAGAATGTGCTAAATCTAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-1165s21c1
Sequence:CCGGGCTCGTCATTTGCGCGAATACCTCGAGGTATTCGCGCAAATGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005382.2-2742s21c1
Sequence:CCGGCACTTCACACGCCATAGTAAACTCGAGTTTACTATGGCGTGTGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005382.2-2956s21c1
Sequence:CCGGGGGATTCAAATGCATGATATTCTCGAGAATATCATGCATTTGAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks