EMAIL THIS PAGE TO A FRIEND

NEIL2

nei endonuclease VIII-like 2 (E. coli)

Synonyms: NEH2 NEI2
UniProtKB ID: Q969S2, B4DFR7, Q7Z3Q7, Q8N842, Q8NG52
Gene ID:
Human(252969) Summary: NEIL2 belongs to a class of DNA glycosylases homologous to the bacterial Fpg/Nei family. These glycosylases initiate the first step in base excision repair by cleaving bases damaged by reactive oxygen species and introducing a DNA strand break via the associated lyase reaction (Bandaru et al., 2002 [PubMed 12509226]
Mouse(382913) nei like 2 (E. coli)
Rat(305957) nei endonuclease VIII-like 2 (E. coli)
naked mole-rat(101708646) nei endonuclease VIII-like 2 (E. coli)
domestic guinea pig(100715945) nei endonuclease VIII-like 2 (E. coli)
sheep(101118667) nei endonuclease VIII-like 2 (E. coli)
chicken(422037) nei endonuclease VIII-like 2 (E. coli)
domestic cat(101084357) nei endonuclease VIII-like 2 (E. coli)
cow(444987) nei endonuclease VIII-like 2 (E. coli)
dog(486078) nei endonuclease VIII-like 2 (E. coli)
Gene Class: Cytoskeleton
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145043 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145043 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145043 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201610 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201610 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201610 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158461 MISSION® esiRNA esiRNA human NEIL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145043 Rosetta Predictions human pricing
NM_001107270 Rosetta Predictions rat pricing
NM_201610 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145043 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223095 predicted 873
2 SASI_Hs02_00364921 predicted 1244
3 SASI_Hs01_00223096 predicted 1073
4 SASI_Hs01_00223097 predicted 918
5 SASI_Hs01_00223098 predicted 998
6 SASI_Hs01_00223099 predicted 1162
7 SASI_Hs01_00223100 predicted 1205
8 SASI_Hs01_00223102 predicted 1289
9 SASI_Hs01_00223103 predicted 1238
10 SASI_Hs01_00223104 predicted 737
11 SASI_Hs01_00223101 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107270 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227185 predicted 650
2 SASI_Rn02_00227186 predicted 716
3 SASI_Rn02_00227187 predicted 690
4 SASI_Rn02_00227188 predicted 449
5 SASI_Rn02_00227189 predicted 709
6 SASI_Rn02_00227190 predicted 644
7 SASI_Rn02_00227191 predicted 713
8 SASI_Rn02_00227192 predicted 738
9 SASI_Rn02_00227193 predicted 250
10 SASI_Rn02_00227194 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048613 predicted 1086
2 SASI_Mm02_00351638 predicted 714
3 SASI_Mm02_00351639 predicted 787
4 SASI_Mm02_00351640 predicted 715
5 SASI_Mm02_00351641 predicted 344
6 SASI_Mm01_00048616 predicted 1182
7 SASI_Mm01_00048617 predicted 918
8 SASI_Mm02_00351642 predicted 1169
9 SASI_Mm02_00351643 predicted 808
10 SASI_Mm01_00048618 predicted 1165
11 SASI_Mm01_00048614 predicted 928
12 SASI_Mm01_00048615 predicted 1108
13 SASI_Mm01_00048619 predicted 950
14 SASI_Mm01_00048620 predicted 987
15 SASI_Mm01_00048621 predicted 1196
16 SASI_Mm01_00048622 predicted 1209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145043
NEIL2 MISSION shRNA Bacterial Glycerol Stock
nei endonuclease VIII-like 2 (E. coli)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145043.2-1463s21c1
Sequence:CCGGACGTGGTGGAGTTCAGTACAGCTCGAGCTGTACTGAACTCCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1720s21c1
Sequence:CCGCGACGTCTAAGTGTCCAGAAAGCTCGAGCTTTCTGGACACTTAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1781s21c1
Sequence:CCGGTCAGAGGTGCCAGTAGTATAACTCGAGTTATACTACTGGCACCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-984s1c1
Sequence:CCGGCGTGTCAGCTTTGGTTTGTTTCTCGAGAAACAAACCAAAGCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1283s1c1
Sequence:CCGGCATCATTAAGAATGAAGCCTTCTCGAGAAGGCTTCATTCTTAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1019s1c1
Sequence:CCGGGAACGATTTCTCCAGAGCCAACTCGAGTTGGCTCTGGAGAAATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1274s1c1
Sequence:CCGGGCTAGGGAACATCATTAAGAACTCGAGTTCTTAATGATGTTCCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-731s1c1
Sequence:CCGGCCATGGAAAGAAATTATTCCTCTCGAGAGGAATAATTTCTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145043
NEIL2 MISSION shRNA shRNA Plasmid DNA
nei endonuclease VIII-like 2 (E. coli)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145043.2-1463s21c1
Sequence:CCGGACGTGGTGGAGTTCAGTACAGCTCGAGCTGTACTGAACTCCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1720s21c1
Sequence:CCGCGACGTCTAAGTGTCCAGAAAGCTCGAGCTTTCTGGACACTTAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1781s21c1
Sequence:CCGGTCAGAGGTGCCAGTAGTATAACTCGAGTTATACTACTGGCACCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-984s1c1
Sequence:CCGGCGTGTCAGCTTTGGTTTGTTTCTCGAGAAACAAACCAAAGCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1283s1c1
Sequence:CCGGCATCATTAAGAATGAAGCCTTCTCGAGAAGGCTTCATTCTTAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1019s1c1
Sequence:CCGGGAACGATTTCTCCAGAGCCAACTCGAGTTGGCTCTGGAGAAATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1274s1c1
Sequence:CCGGGCTAGGGAACATCATTAAGAACTCGAGTTCTTAATGATGTTCCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-731s1c1
Sequence:CCGGCCATGGAAAGAAATTATTCCTCTCGAGAGGAATAATTTCTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145043
NEIL2 MISSION shRNA Lentiviral Transduction Particles
nei endonuclease VIII-like 2 (E. coli)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145043.2-1463s21c1
Sequence:CCGGACGTGGTGGAGTTCAGTACAGCTCGAGCTGTACTGAACTCCACCACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1720s21c1
Sequence:CCGCGACGTCTAAGTGTCCAGAAAGCTCGAGCTTTCTGGACACTTAGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145043.2-1781s21c1
Sequence:CCGGTCAGAGGTGCCAGTAGTATAACTCGAGTTATACTACTGGCACCTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-984s1c1
Sequence:CCGGCGTGTCAGCTTTGGTTTGTTTCTCGAGAAACAAACCAAAGCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1283s1c1
Sequence:CCGGCATCATTAAGAATGAAGCCTTCTCGAGAAGGCTTCATTCTTAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1019s1c1
Sequence:CCGGGAACGATTTCTCCAGAGCCAACTCGAGTTGGCTCTGGAGAAATCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-1274s1c1
Sequence:CCGGGCTAGGGAACATCATTAAGAACTCGAGTTCTTAATGATGTTCCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145043.1-731s1c1
Sequence:CCGGCCATGGAAAGAAATTATTCCTCTCGAGAGGAATAATTTCTTTCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201610
NEIL2 MISSION shRNA Bacterial Glycerol Stock
nei endonuclease VIII-like 2 (E. coli)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201610.1-1613s1c1
Sequence:CCGGCCCTCTAATTTCTTTCTTCTTCTCGAGAAGAAGAAAGAAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-551s1c1
Sequence:CCGGGAATGACTTCTCCAGAGCAAACTCGAGTTTGCTCTGGAGAAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-1008s1c1
Sequence:CCGGCAGGTCATGAAGGAGACATTTCTCGAGAAATGTCTCCTTCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-699s1c1
Sequence:CCGGACCTGTGACATATTGTCTGAACTCGAGTTCAGACAATATGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-700s1c1
Sequence:CCGGCCTGTGACATATTGTCTGAAACTCGAGTTTCAGACAATATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201610
NEIL2 MISSION shRNA shRNA Plasmid DNA
nei endonuclease VIII-like 2 (E. coli)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201610.1-1613s1c1
Sequence:CCGGCCCTCTAATTTCTTTCTTCTTCTCGAGAAGAAGAAAGAAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-551s1c1
Sequence:CCGGGAATGACTTCTCCAGAGCAAACTCGAGTTTGCTCTGGAGAAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-1008s1c1
Sequence:CCGGCAGGTCATGAAGGAGACATTTCTCGAGAAATGTCTCCTTCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-699s1c1
Sequence:CCGGACCTGTGACATATTGTCTGAACTCGAGTTCAGACAATATGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-700s1c1
Sequence:CCGGCCTGTGACATATTGTCTGAAACTCGAGTTTCAGACAATATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201610
NEIL2 MISSION shRNA Lentiviral Transduction Particles
nei endonuclease VIII-like 2 (E. coli)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125604    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201610.1-1613s1c1
Sequence:CCGGCCCTCTAATTTCTTTCTTCTTCTCGAGAAGAAGAAAGAAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-551s1c1
Sequence:CCGGGAATGACTTCTCCAGAGCAAACTCGAGTTTGCTCTGGAGAAGTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-1008s1c1
Sequence:CCGGCAGGTCATGAAGGAGACATTTCTCGAGAAATGTCTCCTTCATGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-699s1c1
Sequence:CCGGACCTGTGACATATTGTCTGAACTCGAGTTCAGACAATATGTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201610.1-700s1c1
Sequence:CCGGCCTGTGACATATTGTCTGAAACTCGAGTTTCAGACAATATGTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks