EMAIL THIS PAGE TO A FRIEND

NEU3

sialidase 3 (membrane sialidase)

Synonyms: SIAL3
UniProtKB ID: Q9UQ49, Q9NQE1
Gene ID:
Human(10825) Summary: This gene product belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. It is localized in the plasma membrane, and its activity is specific for gangliosides. It may play a role in modulating the ganglioside content of the lipid bilayer. [provided by RefSeq, Jul 2008]
Mouse(50877) neuraminidase 3
Rat(117185) sialidase 3 (membrane sialidase)
domestic guinea pig(100733470) sialidase 3 (membrane sialidase)
naked mole-rat(101704883) sialidase 3 (membrane sialidase)
Domestic Rabbit(100354580) sialidase 3 (membrane sialidase)
sheep(101107627) sialidase 3 (membrane sialidase)
chicken(430542) sialidase 3 (membrane sialidase)
dog(485195) sialidase 3 (membrane sialidase)
cow(281349) sialidase 3 (membrane sialidase)
Horse(100064871) sialidase 3 (membrane sialidase)
domestic cat(101080656) sialidase 3 (membrane sialidase)
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006656 Rosetta Predictions human pricing
NM_054010 Rosetta Predictions rat pricing
NM_016720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148985 predicted 852
2 SASI_Hs01_00148987 predicted 255
3 SASI_Hs01_00148988 predicted 1220
4 SASI_Hs02_00342036 predicted 1148
5 SASI_Hs01_00148990 predicted 1433
6 SASI_Hs01_00148991 predicted 681
7 SASI_Hs02_00342037 predicted 381
8 SASI_Hs01_00148992 predicted 879
9 SASI_Hs01_00148993 predicted 609
10 SASI_Hs01_00148994 predicted 595
11 SASI_Hs01_00148986 predicted 1473
12 SASI_Hs01_00148989 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267017 predicted 1176
2 SASI_Rn01_00107469 predicted 1441
3 SASI_Rn01_00107470 predicted 1429
4 SASI_Rn02_00267018 predicted 980
5 SASI_Rn01_00107473 predicted 792
6 SASI_Rn01_00107474 predicted 1439
7 SASI_Rn01_00107475 predicted 1205
8 SASI_Rn01_00107476 predicted 958
9 SASI_Rn01_00107477 predicted 784
10 SASI_Rn01_00107478 predicted 472
11 SASI_Rn01_00107471 predicted 1337
12 SASI_Rn01_00107472 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323415 predicted 1215
2 SASI_Mm02_00323416 predicted 856
3 SASI_Mm02_00323417 predicted 1272
4 SASI_Mm02_00323418 predicted 1430
5 SASI_Mm02_00323419 predicted 701
6 SASI_Mm02_00323420 predicted 1100
7 SASI_Mm02_00323421 predicted 801
8 SASI_Mm02_00323422 predicted 1495
9 SASI_Mm02_00323423 predicted 1582
10 SASI_Mm02_00323424 predicted 1152
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006656
VALIDATED
NEU3 MISSION shRNA Bacterial Glycerol Stock
sialidase 3 (membrane sialidase)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-960s21c1
Sequence:CCGGTGGCCACCCTGTGCTATATTGCTCGAGCAATATAGCACAGGGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-1274s21c1
Sequence:CCGGGGGTTGACCTAGGTATCTATCCTCGAGGATAGATACCTAGGTCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-773s21c1
Sequence:CCGGGACTGGTCATCCCTGCGTATACTCGAGTATACGCAGGGATGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-2248s21c1
Sequence:CCGGTACTGGATAATAGTGCGTATTCTCGAGAATACGCACTATTATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1308s1c1
Sequence:CCGGGCAGAAGAGTGGTTGTGTGTTCTCGAGAACACACAACCACTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006656.4-2924s1c1
Sequence:CCGGCCTACCTTCTACAGCCTTGTACTCGAGTACAAGGCTGTAGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-1554s1c1
Sequence:CCGGCCCTGCGTATACCTACTACATCTCGAGATGTAGTAGGTATACGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1035s1c1
Sequence:CCGGAGTGACAACATGCTCCTTCAACTCGAGTTGAAGGAGCATGTTGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-521s1c1
Sequence:CCGGCCGAGCTACAGACCAATATAACTCGAGTTATATTGGTCTGTAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006656
VALIDATED
NEU3 MISSION shRNA shRNA Plasmid DNA
sialidase 3 (membrane sialidase)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-960s21c1
Sequence:CCGGTGGCCACCCTGTGCTATATTGCTCGAGCAATATAGCACAGGGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-1274s21c1
Sequence:CCGGGGGTTGACCTAGGTATCTATCCTCGAGGATAGATACCTAGGTCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-773s21c1
Sequence:CCGGGACTGGTCATCCCTGCGTATACTCGAGTATACGCAGGGATGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-2248s21c1
Sequence:CCGGTACTGGATAATAGTGCGTATTCTCGAGAATACGCACTATTATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1308s1c1
Sequence:CCGGGCAGAAGAGTGGTTGTGTGTTCTCGAGAACACACAACCACTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006656.4-2924s1c1
Sequence:CCGGCCTACCTTCTACAGCCTTGTACTCGAGTACAAGGCTGTAGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-1554s1c1
Sequence:CCGGCCCTGCGTATACCTACTACATCTCGAGATGTAGTAGGTATACGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1035s1c1
Sequence:CCGGAGTGACAACATGCTCCTTCAACTCGAGTTGAAGGAGCATGTTGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-521s1c1
Sequence:CCGGCCGAGCTACAGACCAATATAACTCGAGTTATATTGGTCTGTAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006656
VALIDATED
NEU3 MISSION shRNA Lentiviral Transduction Particles
sialidase 3 (membrane sialidase)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-960s21c1
Sequence:CCGGTGGCCACCCTGTGCTATATTGCTCGAGCAATATAGCACAGGGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-1274s21c1
Sequence:CCGGGGGTTGACCTAGGTATCTATCCTCGAGGATAGATACCTAGGTCAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-773s21c1
Sequence:CCGGGACTGGTCATCCCTGCGTATACTCGAGTATACGCAGGGATGACCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235534    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_006656.5-2248s21c1
Sequence:CCGGTACTGGATAATAGTGCGTATTCTCGAGAATACGCACTATTATCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1308s1c1
Sequence:CCGGGCAGAAGAGTGGTTGTGTGTTCTCGAGAACACACAACCACTCTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006656.4-2924s1c1
Sequence:CCGGCCTACCTTCTACAGCCTTGTACTCGAGTACAAGGCTGTAGAAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-1554s1c1
Sequence:CCGGCCCTGCGTATACCTACTACATCTCGAGATGTAGTAGGTATACGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_006656.4-1035s1c1
Sequence:CCGGAGTGACAACATGCTCCTTCAACTCGAGTTGAAGGAGCATGTTGTCACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006656.4-521s1c1
Sequence:CCGGCCGAGCTACAGACCAATATAACTCGAGTTATATTGGTCTGTAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016720
NEU3 MISSION shRNA Bacterial Glycerol Stock
sialidase 3 (membrane sialidase)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1275s1c1
Sequence:CCGGGAAGAGGATTAACCTAGGCATCTCGAGATGCCTAGGTTAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016720.1-2991s1c1
Sequence:CCGGGCAGGCATTTACAACTTAGAACTCGAGTTCTAAGTTGTAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1095s1c1
Sequence:CCGGCCAAGGTAGTGTAGTGAGCTTCTCGAGAAGCTCACTACACTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1446s1c1
Sequence:CCGGGCGGATTGACTTCTGTCTGTTCTCGAGAACAGACAGAAGTCAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-804s1c1
Sequence:CCGGCTACTATGTCTCACGTTGGTTCTCGAGAACCAACGTGAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016720
NEU3 MISSION shRNA shRNA Plasmid DNA
sialidase 3 (membrane sialidase)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1275s1c1
Sequence:CCGGGAAGAGGATTAACCTAGGCATCTCGAGATGCCTAGGTTAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016720.1-2991s1c1
Sequence:CCGGGCAGGCATTTACAACTTAGAACTCGAGTTCTAAGTTGTAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1095s1c1
Sequence:CCGGCCAAGGTAGTGTAGTGAGCTTCTCGAGAAGCTCACTACACTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1446s1c1
Sequence:CCGGGCGGATTGACTTCTGTCTGTTCTCGAGAACAGACAGAAGTCAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-804s1c1
Sequence:CCGGCTACTATGTCTCACGTTGGTTCTCGAGAACCAACGTGAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016720
NEU3 MISSION shRNA Lentiviral Transduction Particles
sialidase 3 (membrane sialidase)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1275s1c1
Sequence:CCGGGAAGAGGATTAACCTAGGCATCTCGAGATGCCTAGGTTAATCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016720.1-2991s1c1
Sequence:CCGGGCAGGCATTTACAACTTAGAACTCGAGTTCTAAGTTGTAAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1095s1c1
Sequence:CCGGCCAAGGTAGTGTAGTGAGCTTCTCGAGAAGCTCACTACACTACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-1446s1c1
Sequence:CCGGGCGGATTGACTTCTGTCTGTTCTCGAGAACAGACAGAAGTCAATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016720.1-804s1c1
Sequence:CCGGCTACTATGTCTCACGTTGGTTCTCGAGAACCAACGTGAGACATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks