EMAIL THIS PAGE TO A FRIEND

NEURL

neuralized homolog (Drosophila)

Synonyms: NEURL1 RNF67 bA416N2.1 neu neu-1
UniProtKB ID: O76050, Q5TDR2, Q5TDR3, Q8TAN0, Q9H463
Gene ID:
chicken(423875) neuralized homolog (Drosophila)
cow(510334) neuralized homolog (Drosophila)
domestic cat(101088617) neuralized homolog (Drosophila)
dog(486873) neuralized homolog (Drosophila)
domestic guinea pig(100721634) neuralized homolog (Drosophila)
naked mole-rat(101706351) neuralized homolog (Drosophila)
Domestic Rabbit(100339089) neuralized homolog (Drosophila)
sheep(101113116) neuralized homolog (Drosophila)
32 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004210 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039781 MISSION® esiRNA esiRNA human NEURL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004210 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086760 predicted 494
2 SASI_Hs01_00086761 predicted 1702
3 SASI_Hs01_00086762 predicted 651
4 SASI_Hs01_00086763 predicted 539
5 SASI_Hs02_00337116 predicted 596
6 SASI_Hs02_00337117 predicted 617
7 SASI_Hs01_00086764 predicted 574
8 SASI_Hs01_00086765 predicted 1149
9 SASI_Hs01_00086766 predicted 1274
10 SASI_Hs01_00086767 predicted 1403
11 SASI_Hs01_00086768 predicted 1647
12 SASI_Hs01_00086769 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004210
NEURL MISSION shRNA Bacterial Glycerol Stock
neuralized homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2568s21c1
Sequence:CCGGAGTGCAGCATGGAGTGGATTTCTCGAGAAATCCACTCCATGCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2402s21c1
Sequence:CCGGTGCATGCTGAGGGCTAAATTGCTCGAGCAATTTAGCCCTCAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2427s21c1
Sequence:CCGGCTCAGCCTGCCCTAATCTTTCCTCGAGGAAAGATTAGGGCAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004210.4-913s21c1
Sequence:CCGGTCGCATTCTGGGTGGACAAGACTCGAGTCTTGTCCACCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-649s1c1
Sequence:CCGGCTCGGCTGTTATGCTGTTCTTCTCGAGAAGAACAGCATAACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-169s1c1
Sequence:CCGGCCAGAACCTCAAAGACTCTATCTCGAGATAGAGTCTTTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-392s1c1
Sequence:CCGGCCGGTCCTCATCTACGAGCAACTCGAGTTGCTCGTAGATGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-577s1c1
Sequence:CCGGGTTTGCCAATGAGGGCAACATCTCGAGATGTTGCCCTCATTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-1651s1c1
Sequence:CCGGCGATGAGTGCACCATTTGCTACTCGAGTAGCAAATGGTGCACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004210
NEURL MISSION shRNA shRNA Plasmid DNA
neuralized homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2568s21c1
Sequence:CCGGAGTGCAGCATGGAGTGGATTTCTCGAGAAATCCACTCCATGCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2402s21c1
Sequence:CCGGTGCATGCTGAGGGCTAAATTGCTCGAGCAATTTAGCCCTCAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2427s21c1
Sequence:CCGGCTCAGCCTGCCCTAATCTTTCCTCGAGGAAAGATTAGGGCAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004210.4-913s21c1
Sequence:CCGGTCGCATTCTGGGTGGACAAGACTCGAGTCTTGTCCACCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-649s1c1
Sequence:CCGGCTCGGCTGTTATGCTGTTCTTCTCGAGAAGAACAGCATAACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-169s1c1
Sequence:CCGGCCAGAACCTCAAAGACTCTATCTCGAGATAGAGTCTTTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-392s1c1
Sequence:CCGGCCGGTCCTCATCTACGAGCAACTCGAGTTGCTCGTAGATGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-577s1c1
Sequence:CCGGGTTTGCCAATGAGGGCAACATCTCGAGATGTTGCCCTCATTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-1651s1c1
Sequence:CCGGCGATGAGTGCACCATTTGCTACTCGAGTAGCAAATGGTGCACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004210
NEURL MISSION shRNA Lentiviral Transduction Particles
neuralized homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2568s21c1
Sequence:CCGGAGTGCAGCATGGAGTGGATTTCTCGAGAAATCCACTCCATGCTGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416509    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2402s21c1
Sequence:CCGGTGCATGCTGAGGGCTAAATTGCTCGAGCAATTTAGCCCTCAGCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004210.4-2427s21c1
Sequence:CCGGCTCAGCCTGCCCTAATCTTTCCTCGAGGAAAGATTAGGGCAGGCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004210.4-913s21c1
Sequence:CCGGTCGCATTCTGGGTGGACAAGACTCGAGTCTTGTCCACCCAGAATGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-649s1c1
Sequence:CCGGCTCGGCTGTTATGCTGTTCTTCTCGAGAAGAACAGCATAACAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-169s1c1
Sequence:CCGGCCAGAACCTCAAAGACTCTATCTCGAGATAGAGTCTTTGAGGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-392s1c1
Sequence:CCGGCCGGTCCTCATCTACGAGCAACTCGAGTTGCTCGTAGATGAGGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-577s1c1
Sequence:CCGGGTTTGCCAATGAGGGCAACATCTCGAGATGTTGCCCTCATTGGCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004210.3-1651s1c1
Sequence:CCGGCGATGAGTGCACCATTTGCTACTCGAGTAGCAAATGGTGCACTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks