EMAIL THIS PAGE TO A FRIEND

NEXN

nexilin (F actin binding protein)

Synonyms: CMH20 NELIN
Gene ID:
Human(91624) Summary: This gene encodes a filamentous actin-binding protein that may function in cell adhesion and migration. Mutations in this gene have been associated with dilated cardiomyopathy, also known as CMD1CC. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Mouse(68810) nexilin
Rat(246172) nexilin (F actin binding protein)
Zebrafish(573301) nexilin (F actin binding protein)
chicken(424552) nexilin (F actin binding protein)
domestic cat(101089201) nexilin (F actin binding protein)
cow(504819) nexilin (F actin binding protein)
Horse(100066410) nexilin (F actin binding protein)
dog(490202) nexilin (F actin binding protein)
naked mole-rat(101701446) nexilin (F actin binding protein)
domestic guinea pig(100714534) nexilin (F actin binding protein)
sheep(101122738) nexilin (F actin binding protein)
Gene Class: Cytoskeleton
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144573 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199465 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199465 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199465 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053561 MISSION® esiRNA esiRNA targeting mouse Nexn (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144573 Rosetta Predictions human pricing
NM_139230 Rosetta Predictions rat pricing
NM_139231 Rosetta Predictions rat pricing
NM_199465 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364346 predicted 893
2 SASI_Hs02_00364347 predicted 676
3 SASI_Hs02_00364348 predicted 676
4 SASI_Hs02_00364349 predicted 539
5 SASI_Hs02_00364350 predicted 498
6 SASI_Hs02_00364351 predicted 959
7 SASI_Hs02_00364352 predicted 736
8 SASI_Hs02_00364353 predicted 939
9 SASI_Hs02_00364354 predicted 786
10 SASI_Hs02_00364355 predicted 968
11 SASI_Hs01_00223135 predicted 223
12 SASI_Hs01_00223136 predicted 222
13 SASI_Hs01_00223137 predicted 228
14 SASI_Hs01_00223138 predicted 228
15 SASI_Hs01_00223139 predicted 197
16 SASI_Hs01_00223140 predicted 1357
17 SASI_Hs01_00223141 predicted 1358
18 SASI_Hs01_00223142 predicted 204
19 SASI_Hs01_00223143 predicted 220
20 SASI_Hs01_00223144 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139230 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268527 predicted 1731
2 SASI_Rn01_00050188 predicted 1734
3 SASI_Rn01_00050189 predicted 1640
4 SASI_Rn02_00268528 predicted 1722
5 SASI_Rn02_00268529 predicted 1579
6 SASI_Rn01_00050190 predicted 1569
7 SASI_Rn01_00050191 predicted 1626
8 SASI_Rn01_00050192 predicted 1701
9 SASI_Rn01_00050194 predicted 1717
10 SASI_Rn01_00050195 predicted 1617
11 SASI_Rn01_00050186 predicted 1618
12 SASI_Rn01_00050187 predicted 1742
13 SASI_Rn01_00050193 predicted 1724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139231 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047190 predicted 665
2 SASI_Rn01_00047191 predicted 598
3 SASI_Rn02_00268530 predicted 1573
4 SASI_Rn01_00047196 predicted 832
5 SASI_Rn01_00047197 predicted 646
6 SASI_Rn01_00047198 predicted 915
7 SASI_Rn01_00047199 predicted 1486
8 SASI_Rn02_00268531 predicted 1423
9 SASI_Rn02_00268532 predicted 879
10 SASI_Rn02_00268533 predicted 1470
11 SASI_Rn01_00047192 predicted 1470
12 SASI_Rn01_00047193 predicted 1600
13 SASI_Rn01_00047194 predicted 667
14 SASI_Rn01_00047195 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199465 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095050 predicted 1772
2 SASI_Mm01_00095051 predicted 1576
3 SASI_Mm01_00095052 predicted 1437
4 SASI_Mm01_00095053 predicted 1648
5 SASI_Mm01_00095054 predicted 1414
6 SASI_Mm01_00095055 predicted 2001
7 SASI_Mm01_00095056 predicted 853
8 SASI_Mm01_00095057 predicted 919
9 SASI_Mm01_00095058 predicted 1115
10 SASI_Mm01_00095059 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144573
VALIDATED
NEXN MISSION shRNA Bacterial Glycerol Stock
nexilin (F actin binding protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144573.1-1727s1c1
Sequence:CCGGGCCACTATGCTGACTTCTTATCTCGAGATAAGAAGTCAGCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-144s1c1
Sequence:CCGGGCTGAACAGATTGAGGACATACTCGAGTATGTCCTCAATCTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1350s1c1
Sequence:CCGGCCAGAAATTACATGGTGGTTTCTCGAGAAACCACCATGTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-1432s1c1
Sequence:CCGGGCCTTTACTTACCAGAAACTTCTCGAGAAGTTTCTGGTAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1028s1c1
Sequence:CCGGCGAGGCTCCATTTACTCACAACTCGAGTTGTGAGTAAATGGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144573.3-2591s21c1
Sequence:CCGGCATCAGATTTATCGCCTATTACTCGAGTAATAGGCGATAAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1485s21c1
Sequence:CCGGACGGAAGCATAAGCTAGAAATCTCGAGATTTCTAGCTTATGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1615s21c1
Sequence:CCGGAGTGGCTCTATTCAAGCTAAACTCGAGTTTAGCTTGAATAGAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-372s21c1
Sequence:CCGGACTTGGCAAGGGTGATGTAAACTCGAGTTTACATCACCCTTGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144573
VALIDATED
NEXN MISSION shRNA shRNA Plasmid DNA
nexilin (F actin binding protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144573.1-1727s1c1
Sequence:CCGGGCCACTATGCTGACTTCTTATCTCGAGATAAGAAGTCAGCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-144s1c1
Sequence:CCGGGCTGAACAGATTGAGGACATACTCGAGTATGTCCTCAATCTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1350s1c1
Sequence:CCGGCCAGAAATTACATGGTGGTTTCTCGAGAAACCACCATGTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-1432s1c1
Sequence:CCGGGCCTTTACTTACCAGAAACTTCTCGAGAAGTTTCTGGTAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1028s1c1
Sequence:CCGGCGAGGCTCCATTTACTCACAACTCGAGTTGTGAGTAAATGGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144573.3-2591s21c1
Sequence:CCGGCATCAGATTTATCGCCTATTACTCGAGTAATAGGCGATAAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1485s21c1
Sequence:CCGGACGGAAGCATAAGCTAGAAATCTCGAGATTTCTAGCTTATGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1615s21c1
Sequence:CCGGAGTGGCTCTATTCAAGCTAAACTCGAGTTTAGCTTGAATAGAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-372s21c1
Sequence:CCGGACTTGGCAAGGGTGATGTAAACTCGAGTTTACATCACCCTTGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144573
VALIDATED
NEXN MISSION shRNA Lentiviral Transduction Particles
nexilin (F actin binding protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123129    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144573.1-1727s1c1
Sequence:CCGGGCCACTATGCTGACTTCTTATCTCGAGATAAGAAGTCAGCATAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-144s1c1
Sequence:CCGGGCTGAACAGATTGAGGACATACTCGAGTATGTCCTCAATCTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1350s1c1
Sequence:CCGGCCAGAAATTACATGGTGGTTTCTCGAGAAACCACCATGTAATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144573.1-1432s1c1
Sequence:CCGGGCCTTTACTTACCAGAAACTTCTCGAGAAGTTTCTGGTAAGTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144573.1-1028s1c1
Sequence:CCGGCGAGGCTCCATTTACTCACAACTCGAGTTGTGAGTAAATGGAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431373    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144573.3-2591s21c1
Sequence:CCGGCATCAGATTTATCGCCTATTACTCGAGTAATAGGCGATAAATCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1485s21c1
Sequence:CCGGACGGAAGCATAAGCTAGAAATCTCGAGATTTCTAGCTTATGCTTCCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-1615s21c1
Sequence:CCGGAGTGGCTCTATTCAAGCTAAACTCGAGTTTAGCTTGAATAGAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144573.3-372s21c1
Sequence:CCGGACTTGGCAAGGGTGATGTAAACTCGAGTTTACATCACCCTTGCCAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199465
NEXN MISSION shRNA Bacterial Glycerol Stock
nexilin (F actin binding protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-199s1c1
Sequence:CCGGCCAAAGCTAACAGGGACAGTTCTCGAGAACTGTCCCTGTTAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-552s1c1
Sequence:CCGGCCGAGTTCTCAAAGAAGCAAACTCGAGTTTGCTTCTTTGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-947s1c1
Sequence:CCGGGCATGGTATTAGATGATGATTCTCGAGAATCATCATCTAATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-1728s1c1
Sequence:CCGGGCCGGAAATTACATGGTGGTTCTCGAGAACCACCATGTAATTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199465.1-2189s1c1
Sequence:CCGGGCATGAATAAACTGGAGATTTCTCGAGAAATCTCCAGTTTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199465
NEXN MISSION shRNA shRNA Plasmid DNA
nexilin (F actin binding protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-199s1c1
Sequence:CCGGCCAAAGCTAACAGGGACAGTTCTCGAGAACTGTCCCTGTTAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-552s1c1
Sequence:CCGGCCGAGTTCTCAAAGAAGCAAACTCGAGTTTGCTTCTTTGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-947s1c1
Sequence:CCGGGCATGGTATTAGATGATGATTCTCGAGAATCATCATCTAATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-1728s1c1
Sequence:CCGGGCCGGAAATTACATGGTGGTTCTCGAGAACCACCATGTAATTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199465.1-2189s1c1
Sequence:CCGGGCATGAATAAACTGGAGATTTCTCGAGAAATCTCCAGTTTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199465
NEXN MISSION shRNA Lentiviral Transduction Particles
nexilin (F actin binding protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-199s1c1
Sequence:CCGGCCAAAGCTAACAGGGACAGTTCTCGAGAACTGTCCCTGTTAGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-552s1c1
Sequence:CCGGCCGAGTTCTCAAAGAAGCAAACTCGAGTTTGCTTCTTTGAGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-947s1c1
Sequence:CCGGGCATGGTATTAGATGATGATTCTCGAGAATCATCATCTAATACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199465.1-1728s1c1
Sequence:CCGGGCCGGAAATTACATGGTGGTTCTCGAGAACCACCATGTAATTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114146    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_199465.1-2189s1c1
Sequence:CCGGGCATGAATAAACTGGAGATTTCTCGAGAAATCTCCAGTTTATTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks