EMAIL THIS PAGE TO A FRIEND

NFATC2

nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2

Synonyms: NFAT1 NFATP
Gene ID:
Human(4773) Summary: This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
Mouse(18019) nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
Rat(311658) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
chicken(419346) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
domestic cat(101080520) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
cow(530401) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Horse(100052657) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
dog(485930) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
sheep(101119239) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
domestic guinea pig(100722868) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
naked mole-rat(101722005) nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N7032 NFAT Inhibitor >96% (HPLC), solid human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012340 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012340 Rosetta Predictions human pricing
NM_173091 Rosetta Predictions human pricing
NM_001107805 Rosetta Predictions rat pricing
NM_001037177 Rosetta Predictions mouse pricing
NM_001037178 Rosetta Predictions mouse pricing
NM_010899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195473 predicted 1601
2 SASI_Hs01_00195476 predicted 1710
3 SASI_Hs01_00195477 predicted 1985
4 SASI_Hs01_00195478 predicted 863
5 SASI_Hs01_00195479 predicted 1122
6 SASI_Hs01_00195480 predicted 412
7 SASI_Hs01_00195481 predicted 1290
8 SASI_Hs01_00195482 predicted 1791
9 SASI_Hs02_00344139 predicted 1778
10 SASI_Hs02_00344140 predicted 1879
11 SASI_Hs01_00195474 predicted 1899
12 SASI_Hs01_00195475 predicted 2165
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173091 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077368 predicted 1604
2 SASI_Hs01_00077370 predicted 2158
3 SASI_Hs01_00077371 predicted 1708
4 SASI_Hs01_00077372 predicted 1980
5 SASI_Hs01_00077373 predicted 868
6 SASI_Hs01_00077374 predicted 1119
7 SASI_Hs01_00077375 predicted 412
8 SASI_Hs01_00077376 predicted 1299
9 SASI_Hs01_00077377 predicted 1787
10 SASI_Hs02_00368116 predicted 1874
11 SASI_Hs01_00077369 predicted 1890
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232445 predicted 2807
2 SASI_Rn02_00232446 predicted 342
3 SASI_Rn02_00232447 predicted 1306
4 SASI_Rn02_00232448 predicted 733
5 SASI_Rn02_00232449 predicted 2580
6 SASI_Rn02_00232450 predicted 2814
7 SASI_Rn02_00232451 predicted 2056
8 SASI_Rn02_00232452 predicted 2101
9 SASI_Rn02_00232453 predicted 1658
10 SASI_Rn02_00232454 predicted 2886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037183 predicted 1546
2 SASI_Mm01_00037184 predicted 1390
3 SASI_Mm01_00037185 predicted 1377
4 SASI_Mm01_00037186 predicted 1273
5 SASI_Mm01_00037187 predicted 1235
6 SASI_Mm02_00289295 predicted 1058
7 SASI_Mm01_00037188 predicted 1732
8 SASI_Mm01_00037189 predicted 1362
9 SASI_Mm01_00037190 predicted 1374
10 SASI_Mm01_00037191 predicted 1571
11 SASI_Mm01_00037192 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037178 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081671 predicted 925
2 SASI_Mm01_00081672 predicted 769
3 SASI_Mm01_00081673 predicted 759
4 SASI_Mm01_00081674 predicted 653
5 SASI_Mm01_00081675 predicted 614
6 SASI_Mm02_00289296 predicted 439
7 SASI_Mm01_00081676 predicted 1108
8 SASI_Mm01_00081677 predicted 745
9 SASI_Mm01_00081678 predicted 753
10 SASI_Mm01_00081679 predicted 955
11 SASI_Mm01_00081680 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101476 predicted 1485
2 SASI_Mm01_00101477 predicted 1329
3 SASI_Mm01_00101478 predicted 1314
4 SASI_Mm01_00101479 predicted 1209
5 SASI_Mm01_00101480 predicted 1174
6 SASI_Mm02_00319617 predicted 993
7 SASI_Mm01_00101481 predicted 1668
8 SASI_Mm01_00101482 predicted 1297
9 SASI_Mm01_00101483 predicted 1312
10 SASI_Mm01_00101484 predicted 1502
11 SASI_Mm01_00101485 predicted 1239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012340
NFATC2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2034s1c1
Sequence:CCGGCCGAGTCCAAAGTTGTGTTTACTCGAGTAAACACAACTTTGGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-316s1c1
Sequence:CCGGCCTCTTCGACTATGAGTATTTCTCGAGAAATACTCATAGTCGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-870s1c1
Sequence:CCGGCGCCAATAATGTCACCTCGAACTCGAGTTCGAGGTGACATTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2707s1c1
Sequence:CCGGGCACATCATGTACTGCGAGAACTCGAGTTCTCGCAGTACATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2186s1c1
Sequence:CCGGGTGAACTTCTACGTCATCAATCTCGAGATTGATGACGTAGAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1779s21c1
Sequence:CCGGAGCTTAGAAACGCCGACATTGCTCGAGCAATGTCGGCGTTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-315s21c1
Sequence:CCGGTCCTCTTCGACTATGAGTATTCTCGAGAATACTCATAGTCGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012340.3-2999s21c1
Sequence:GTACCGGGTGATCTTTGATCCGAGAAATCTCGAGATTTCTCGGATCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1606s21c1
Sequence:CCGGAGCTGATGAGCGGATCCTTAACTCGAGTTAAGGATCCGCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-2267s21c1
Sequence:CCGGACGGAGCCCACGGATGAATATCTCGAGATATTCATCCGTGGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012340
NFATC2 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2034s1c1
Sequence:CCGGCCGAGTCCAAAGTTGTGTTTACTCGAGTAAACACAACTTTGGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-316s1c1
Sequence:CCGGCCTCTTCGACTATGAGTATTTCTCGAGAAATACTCATAGTCGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-870s1c1
Sequence:CCGGCGCCAATAATGTCACCTCGAACTCGAGTTCGAGGTGACATTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2707s1c1
Sequence:CCGGGCACATCATGTACTGCGAGAACTCGAGTTCTCGCAGTACATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2186s1c1
Sequence:CCGGGTGAACTTCTACGTCATCAATCTCGAGATTGATGACGTAGAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1779s21c1
Sequence:CCGGAGCTTAGAAACGCCGACATTGCTCGAGCAATGTCGGCGTTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-315s21c1
Sequence:CCGGTCCTCTTCGACTATGAGTATTCTCGAGAATACTCATAGTCGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012340.3-2999s21c1
Sequence:GTACCGGGTGATCTTTGATCCGAGAAATCTCGAGATTTCTCGGATCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1606s21c1
Sequence:CCGGAGCTGATGAGCGGATCCTTAACTCGAGTTAAGGATCCGCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-2267s21c1
Sequence:CCGGACGGAGCCCACGGATGAATATCTCGAGATATTCATCCGTGGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012340
NFATC2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2034s1c1
Sequence:CCGGCCGAGTCCAAAGTTGTGTTTACTCGAGTAAACACAACTTTGGACTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-316s1c1
Sequence:CCGGCCTCTTCGACTATGAGTATTTCTCGAGAAATACTCATAGTCGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-870s1c1
Sequence:CCGGCGCCAATAATGTCACCTCGAACTCGAGTTCGAGGTGACATTATTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2707s1c1
Sequence:CCGGGCACATCATGTACTGCGAGAACTCGAGTTCTCGCAGTACATGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012340.2-2186s1c1
Sequence:CCGGGTGAACTTCTACGTCATCAATCTCGAGATTGATGACGTAGAAGTTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1779s21c1
Sequence:CCGGAGCTTAGAAACGCCGACATTGCTCGAGCAATGTCGGCGTTTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-315s21c1
Sequence:CCGGTCCTCTTCGACTATGAGTATTCTCGAGAATACTCATAGTCGAAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217956    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012340.3-2999s21c1
Sequence:GTACCGGGTGATCTTTGATCCGAGAAATCTCGAGATTTCTCGGATCAAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-1606s21c1
Sequence:CCGGAGCTGATGAGCGGATCCTTAACTCGAGTTAAGGATCCGCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012340.3-2267s21c1
Sequence:CCGGACGGAGCCCACGGATGAATATCTCGAGATATTCATCCGTGGGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010899
VALIDATED
NFATC2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2133s1c1
Sequence:CCGGGCGATGAGTATGAACCATCTTCTCGAGAAGATGGTTCATACTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-2032s1c1
Sequence:CCGGGCCCGTGAAAGTCAACTTCTACTCGAGTAGAAGTTGACTTTCACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-190s1c1
Sequence:CCGGCCCTATCGAAGAAGAACCGATCTCGAGATCGGTTCTTCTTCGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2797s1c1
Sequence:CCGGCGTTAATGAAATCATCAGGAACTCGAGTTCCTGATGATTTCATTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010899.1-3128s1c1
Sequence:CCGGCCCACAGACATGGCTTCATTTCTCGAGAAATGAAGCCATGTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-221s21c1
Sequence:CCGGAGAAGAACCGATCGCACATAACTCGAGTTATGTGCGATCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-181s21c1
Sequence:CCGGTTTCCATCCTCTTCGATTATGCTCGAGCATAATCGAAGAGGATGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-348s21c1
Sequence:CCGGTTCGGAGAGCCGGATAGTATACTCGAGTATACTATCCGGCTCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010899.2-5107s21c1
Sequence:CCGGCCAGATCAGTATGGTATTAAACTCGAGTTTAATACCATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-1968s21c1
Sequence:CCGGATGGAAGCTACGGTGGATAAACTCGAGTTTATCCACCGTAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010899
VALIDATED
NFATC2 MISSION shRNA shRNA Plasmid DNA
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2133s1c1
Sequence:CCGGGCGATGAGTATGAACCATCTTCTCGAGAAGATGGTTCATACTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-2032s1c1
Sequence:CCGGGCCCGTGAAAGTCAACTTCTACTCGAGTAGAAGTTGACTTTCACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-190s1c1
Sequence:CCGGCCCTATCGAAGAAGAACCGATCTCGAGATCGGTTCTTCTTCGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2797s1c1
Sequence:CCGGCGTTAATGAAATCATCAGGAACTCGAGTTCCTGATGATTTCATTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010899.1-3128s1c1
Sequence:CCGGCCCACAGACATGGCTTCATTTCTCGAGAAATGAAGCCATGTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-221s21c1
Sequence:CCGGAGAAGAACCGATCGCACATAACTCGAGTTATGTGCGATCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-181s21c1
Sequence:CCGGTTTCCATCCTCTTCGATTATGCTCGAGCATAATCGAAGAGGATGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-348s21c1
Sequence:CCGGTTCGGAGAGCCGGATAGTATACTCGAGTATACTATCCGGCTCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010899.2-5107s21c1
Sequence:CCGGCCAGATCAGTATGGTATTAAACTCGAGTTTAATACCATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-1968s21c1
Sequence:CCGGATGGAAGCTACGGTGGATAAACTCGAGTTTATCCACCGTAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010899
VALIDATED
NFATC2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2133s1c1
Sequence:CCGGGCGATGAGTATGAACCATCTTCTCGAGAAGATGGTTCATACTCATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-2032s1c1
Sequence:CCGGGCCCGTGAAAGTCAACTTCTACTCGAGTAGAAGTTGACTTTCACGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010899.1-190s1c1
Sequence:CCGGCCCTATCGAAGAAGAACCGATCTCGAGATCGGTTCTTCTTCGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010899.1-2797s1c1
Sequence:CCGGCGTTAATGAAATCATCAGGAACTCGAGTTCCTGATGATTTCATTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012353    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010899.1-3128s1c1
Sequence:CCGGCCCACAGACATGGCTTCATTTCTCGAGAAATGAAGCCATGTCTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-221s21c1
Sequence:CCGGAGAAGAACCGATCGCACATAACTCGAGTTATGTGCGATCGGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-181s21c1
Sequence:CCGGTTTCCATCCTCTTCGATTATGCTCGAGCATAATCGAAGAGGATGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-348s21c1
Sequence:CCGGTTCGGAGAGCCGGATAGTATACTCGAGTATACTATCCGGCTCTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010899.2-5107s21c1
Sequence:CCGGCCAGATCAGTATGGTATTAAACTCGAGTTTAATACCATACTGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010899.2-1968s21c1
Sequence:CCGGATGGAAGCTACGGTGGATAAACTCGAGTTTATCCACCGTAGCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks