EMAIL THIS PAGE TO A FRIEND

NFKB2

nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)

Synonyms: H2TF1 LYT-10 LYT10 NF-kB2 p105 p52
Gene ID:
Human(4791) Summary: This gene encodes one of the subunits of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB transcription factor complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The NFkB complex can consist of different subunits that form both homo- or heterodimers which bind specific kappa-B elements in target genes. This gene encodes the p100 subunit that is processed into the active p52 subunit. This protein can function as both a transcriptional activator and repressor, depending on its dimer partner. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, May 2012]
Mouse(18034) nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Rat(309452) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100
Zebrafish(415100) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100
chicken(386574) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
domestic cat(101080578) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
cow(526392) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
dog(486858) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
naked mole-rat(101714147) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
domestic guinea pig(100715820) nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301056 ANTI-MOUSE NFKB2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4501992 Anti-NF-κB p100, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB4501993 Anti-NF-κB p100, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB1305945 ANTI-NFKB(P100) (C-TERM S866/870) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300299 Anti-NFKB2 (Ab-866) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry pricing
SAB4300300 Anti-NFKB2 (Ab-870) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry pricing
SAB4300545 Anti-NFKB2 (Ab-872) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
AV32043 Anti-NFKB2 (AB1) antibody produced in rabbit affinity isolated antibody human, bovine, horse, rabbit
immunohistochemistry, western blot pricing
AV32718 Anti-NFKB2 (AB2) antibody produced in rabbit affinity isolated antibody bovine, mouse, rabbit, canine, horse, rat, human, guinea pig
immunohistochemistry, western blot pricing
HPA008422 Anti-NFKB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA023900 Anti-NFKB2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4504261 Anti-phospho-NF-kappaB p100 (pSer872) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504483 Anti-phospho-NF-kappaB p100/p52 (pSer865) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunoprecipitation, western blot pricing
SAB4504484 Anti-phospho-NF-kappaB p100/p52 (pSer869) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4301419 Anti-phospho-NF-κB p100 (pSer872) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
PLA0215 Rabbit anti-NF-kappaB2 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. primate, mouse, guinea pig, gibbon, rabbit, rhesus monkey, human
immunoprecipitation, proximity ligation assay, western blot pricing

Small Molecule - Blocker

Product # Description Species Add to Cart
 
T7254 Nα-Tosyl-L-lysine chloromethyl ketone hydrochloride ≥96% (TLC), powder human pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C8221 Caffeic acid phenethyl ester ≥97% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077493 Rosetta Predictions human pricing
NM_001077494 Rosetta Predictions human pricing
NM_002502 Rosetta Predictions human pricing
NM_001008349 Rosetta Predictions rat pricing
NM_019408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077493 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312814 predicted 431
2 SASI_Hs02_00312815 predicted 870
3 SASI_Hs02_00312816 predicted 1169
4 SASI_Hs02_00312817 predicted 344
5 SASI_Hs02_00312818 predicted 965
6 SASI_Hs02_00312819 predicted 1171
7 SASI_Hs02_00312820 predicted 1700
8 SASI_Hs02_00312821 predicted 1700
9 SASI_Hs02_00312822 predicted 926
10 SASI_Hs02_00312823 predicted 1039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312824 predicted 499
2 SASI_Hs02_00312825 predicted 933
3 SASI_Hs02_00312826 predicted 1232
4 SASI_Hs02_00312827 predicted 417
5 SASI_Hs02_00312828 predicted 1031
6 SASI_Hs02_00312829 predicted 1228
7 SASI_Hs02_00312830 predicted 1769
8 SASI_Hs02_00312831 predicted 1760
9 SASI_Hs02_00312832 predicted 985
10 SASI_Hs02_00312833 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138464 predicted 427
2 SASI_Hs02_00333961 predicted 863
3 SASI_Hs01_00138465 predicted 1159
4 SASI_Hs02_00333962 predicted 341
5 SASI_Hs02_00333963 predicted 963
6 SASI_Hs01_00138466 predicted 1157
7 SASI_Hs01_00138467 predicted 1700
8 SASI_Hs01_00138469 predicted 1689
9 SASI_Hs01_00138470 predicted 916
10 SASI_Hs01_00138471 predicted 1029
11 SASI_Hs01_00138468 predicted 959
12 SASI_Hs01_00138472 predicted 896
13 SASI_Hs01_00138473 predicted 2381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100431 predicted 1768
2 SASI_Rn01_00100432 predicted 490
3 SASI_Rn01_00100433 predicted 481
4 SASI_Rn01_00100434 predicted 1003
5 SASI_Rn01_00100435 predicted 1730
6 SASI_Rn01_00100436 predicted 1769
7 SASI_Rn01_00100437 predicted 2483
8 SASI_Rn01_00100438 predicted 1153
9 SASI_Rn01_00100439 predicted 811
10 SASI_Rn02_00199101 predicted 1022
11 SASI_Rn01_00100440 predicted 1853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151272 predicted 647
2 SASI_Mm01_00151273 predicted 1234
3 SASI_Mm01_00151274 predicted 2485
4 SASI_Mm02_00324332 predicted 1170
5 SASI_Mm01_00151276 predicted 710
6 SASI_Mm01_00151277 predicted 1787
7 SASI_Mm01_00151278 predicted 496
8 SASI_Mm01_00151279 predicted 1788
9 SASI_Mm01_00151280 predicted 1869
10 SASI_Mm01_00151281 predicted 1227
11 SASI_Mm01_00151275 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019408
VALIDATED
NFKB2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1043s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-418s21c1
Sequence:CCGGCGAGGCTTCAGATTTCGATATCTCGAGATATCGAAATCTGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-994s21c1
Sequence:CCGGCGCGGTGGAGACGAAGTTTATCTCGAGATAAACTTCGTCTCCACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-653s21c1
Sequence:CCGGAGGACATGACTGCTCAATTTACTCGAGTAAATTGAGCAGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-1788s21c1
Sequence:CCGGGCAGATAGCCCACGTCATTTACTCGAGTAAATGACGTGGGCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1101s21c1
Sequence:CCGGCTCTCCCACAGACGTTCATAACTCGAGTTATGAACGTCTGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2996s21c1
Sequence:CCGGCAGATCCCTCTGTACAGCATCCTCGAGGATGCTGTACAGAGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2716s21c1
Sequence:CCGGGGCAGTCTCCTTCGTAGTTACCTCGAGGTAACTACGAAGGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-2319s21c1
Sequence:CCGGTCTTACTCGCCTCCTTCTAAACTCGAGTTTAGAAGGAGGCGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1230s21c1
Sequence:CCGGCTCCAAACAGTTCACATATTACTCGAGTAATATGTGAACTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-1800s1c1
Sequence:CCGGCGTCATTTATCACGCTCAGTACTCGAGTACTGAGCGTGATAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-1226s1c1
Sequence:CCGGCGGACTCCAAACAGTTCACATCTCGAGATGTGAACTGTTTGGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-417s1c1
Sequence:CCGGGCGAGGCTTCAGATTTCGATACTCGAGTATCGAAATCTGAAGCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-687s1c1
Sequence:CCGGCCTGCATGTAACCAAGAAGAACTCGAGTTCTTCTTGGTTACATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-3017s1c1
Sequence:CCGGCCTGTCTAATCGAAATCTTATCTCGAGATAAGATTTCGATTAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019408
VALIDATED
NFKB2 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1043s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-418s21c1
Sequence:CCGGCGAGGCTTCAGATTTCGATATCTCGAGATATCGAAATCTGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-994s21c1
Sequence:CCGGCGCGGTGGAGACGAAGTTTATCTCGAGATAAACTTCGTCTCCACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-653s21c1
Sequence:CCGGAGGACATGACTGCTCAATTTACTCGAGTAAATTGAGCAGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-1788s21c1
Sequence:CCGGGCAGATAGCCCACGTCATTTACTCGAGTAAATGACGTGGGCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1101s21c1
Sequence:CCGGCTCTCCCACAGACGTTCATAACTCGAGTTATGAACGTCTGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2996s21c1
Sequence:CCGGCAGATCCCTCTGTACAGCATCCTCGAGGATGCTGTACAGAGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2716s21c1
Sequence:CCGGGGCAGTCTCCTTCGTAGTTACCTCGAGGTAACTACGAAGGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-2319s21c1
Sequence:CCGGTCTTACTCGCCTCCTTCTAAACTCGAGTTTAGAAGGAGGCGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1230s21c1
Sequence:CCGGCTCCAAACAGTTCACATATTACTCGAGTAATATGTGAACTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-1800s1c1
Sequence:CCGGCGTCATTTATCACGCTCAGTACTCGAGTACTGAGCGTGATAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-1226s1c1
Sequence:CCGGCGGACTCCAAACAGTTCACATCTCGAGATGTGAACTGTTTGGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-417s1c1
Sequence:CCGGGCGAGGCTTCAGATTTCGATACTCGAGTATCGAAATCTGAAGCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-687s1c1
Sequence:CCGGCCTGCATGTAACCAAGAAGAACTCGAGTTCTTCTTGGTTACATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-3017s1c1
Sequence:CCGGCCTGTCTAATCGAAATCTTATCTCGAGATAAGATTTCGATTAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019408
VALIDATED
NFKB2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1043s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-418s21c1
Sequence:CCGGCGAGGCTTCAGATTTCGATATCTCGAGATATCGAAATCTGAAGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-994s21c1
Sequence:CCGGCGCGGTGGAGACGAAGTTTATCTCGAGATAAACTTCGTCTCCACCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-653s21c1
Sequence:CCGGAGGACATGACTGCTCAATTTACTCGAGTAAATTGAGCAGTCATGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-1788s21c1
Sequence:CCGGGCAGATAGCCCACGTCATTTACTCGAGTAAATGACGTGGGCTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1101s21c1
Sequence:CCGGCTCTCCCACAGACGTTCATAACTCGAGTTATGAACGTCTGTGGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235403    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2996s21c1
Sequence:CCGGCAGATCCCTCTGTACAGCATCCTCGAGGATGCTGTACAGAGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019408.2-2716s21c1
Sequence:CCGGGGCAGTCTCCTTCGTAGTTACCTCGAGGTAACTACGAAGGAGACTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-2319s21c1
Sequence:CCGGTCTTACTCGCCTCCTTCTAAACTCGAGTTTAGAAGGAGGCGAGTAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019408.2-1230s21c1
Sequence:CCGGCTCCAAACAGTTCACATATTACTCGAGTAATATGTGAACTGTTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-1800s1c1
Sequence:CCGGCGTCATTTATCACGCTCAGTACTCGAGTACTGAGCGTGATAAATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-1226s1c1
Sequence:CCGGCGGACTCCAAACAGTTCACATCTCGAGATGTGAACTGTTTGGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-417s1c1
Sequence:CCGGGCGAGGCTTCAGATTTCGATACTCGAGTATCGAAATCTGAAGCCTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019408.1-687s1c1
Sequence:CCGGCCTGCATGTAACCAAGAAGAACTCGAGTTCTTCTTGGTTACATGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012343    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019408.1-3017s1c1
Sequence:CCGGCCTGTCTAATCGAAATCTTATCTCGAGATAAGATTTCGATTAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002502
NFKB2 MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-964s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1702s21c1
Sequence:CCGGTCATTGAGCAGATAGTCTATGCTCGAGCATAGACTATCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-575s21c1
Sequence:CCGGGGACATGACTGCCCAATTTAACTCGAGTTAAATTGGGCAGTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1152s21c1
Sequence:CCGGTCCAAACAGTTCACCTATTACCTCGAGGTAATAGGTGAACTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-2395s1c1
Sequence:CCGGGCTGCTAAATGCTGCTCAGAACTCGAGTTCTGAGCAGCATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-317s1c1
Sequence:CCGGCGATTTCGATATGGCTGTGAACTCGAGTTCACAGCCATATCGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1067s1c1
Sequence:CCGGCCTGTAACAGTGTTTCTGCAACTCGAGTTGCAGAAACACTGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-554s1c1
Sequence:CCGGGCCCAATTTAACAACCTGGGTCTCGAGACCCAGGTTGTTAAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1040s1c1
Sequence:CCGGCCCTATCACAAGATGAAGATTCTCGAGAATCTTCATCTTGTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002502
NFKB2 MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-964s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1702s21c1
Sequence:CCGGTCATTGAGCAGATAGTCTATGCTCGAGCATAGACTATCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-575s21c1
Sequence:CCGGGGACATGACTGCCCAATTTAACTCGAGTTAAATTGGGCAGTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1152s21c1
Sequence:CCGGTCCAAACAGTTCACCTATTACCTCGAGGTAATAGGTGAACTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-2395s1c1
Sequence:CCGGGCTGCTAAATGCTGCTCAGAACTCGAGTTCTGAGCAGCATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-317s1c1
Sequence:CCGGCGATTTCGATATGGCTGTGAACTCGAGTTCACAGCCATATCGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1067s1c1
Sequence:CCGGCCTGTAACAGTGTTTCTGCAACTCGAGTTGCAGAAACACTGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-554s1c1
Sequence:CCGGGCCCAATTTAACAACCTGGGTCTCGAGACCCAGGTTGTTAAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1040s1c1
Sequence:CCGGCCCTATCACAAGATGAAGATTCTCGAGAATCTTCATCTTGTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002502
NFKB2 MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-964s21c1
Sequence:CCGGACATTGAGGTTCGGTTCTATGCTCGAGCATAGAACCGAACCTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1702s21c1
Sequence:CCGGTCATTGAGCAGATAGTCTATGCTCGAGCATAGACTATCTGCTCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-575s21c1
Sequence:CCGGGGACATGACTGCCCAATTTAACTCGAGTTAAATTGGGCAGTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002502.3-1152s21c1
Sequence:CCGGTCCAAACAGTTCACCTATTACCTCGAGGTAATAGGTGAACTGTTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-2395s1c1
Sequence:CCGGGCTGCTAAATGCTGCTCAGAACTCGAGTTCTGAGCAGCATTTAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-317s1c1
Sequence:CCGGCGATTTCGATATGGCTGTGAACTCGAGTTCACAGCCATATCGAAATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006515    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1067s1c1
Sequence:CCGGCCTGTAACAGTGTTTCTGCAACTCGAGTTGCAGAAACACTGTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-554s1c1
Sequence:CCGGGCCCAATTTAACAACCTGGGTCTCGAGACCCAGGTTGTTAAATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002502.2-1040s1c1
Sequence:CCGGCCCTATCACAAGATGAAGATTCTCGAGAATCTTCATCTTGTGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks