EMAIL THIS PAGE TO A FRIEND

NFKBIE

nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon

Synonyms: IKBE
UniProtKB ID: O00221, Q5T9V9
Gene ID:
Human(4794) Summary: The protein encoded by this gene binds to components of NF-kappa-B, trapping the complex in the cytoplasm and preventing it from activating genes in the nucleus. Phosphorylation of the encoded protein targets it for destruction by the ubiquitin pathway, which activates NF-kappa-B by making it available to translocate to the nucleus. [provided by RefSeq, Sep 2011]
Mouse(18037) nuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, epsilon
Rat(316241) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Zebrafish(790944) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
cow(506727) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
domestic cat(101096065) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
dog(609647) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
chicken(421438) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
naked mole-rat(101697721) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
domestic guinea pig(100729666) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
sheep(101118312) nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004556 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU043691 MISSION® esiRNA esiRNA human NFKBIE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004556 Rosetta Predictions human pricing
NM_199111 Rosetta Predictions rat pricing
NM_008690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00223015 predicted 1403
2 SASI_Hs01_00223016 predicted 1763
3 SASI_Hs02_00337879 predicted 1916
4 SASI_Hs01_00223017 predicted 1946
5 SASI_Hs01_00223018 predicted 2006
6 SASI_Hs01_00223019 predicted 1494
7 SASI_Hs01_00223020 predicted 984
8 SASI_Hs01_00223021 predicted 1143
9 SASI_Hs01_00223022 predicted 764
10 SASI_Hs01_00223023 predicted 948
11 SASI_Hs01_00223024 predicted 1450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102866 predicted 910
2 SASI_Rn02_00270133 predicted 889
3 SASI_Rn01_00102868 predicted 729
4 SASI_Rn01_00102870 predicted 1076
5 SASI_Rn01_00102871 predicted 904
6 SASI_Rn01_00102872 predicted 630
7 SASI_Rn01_00102873 predicted 784
8 SASI_Rn01_00102874 predicted 551
9 SASI_Rn01_00102875 predicted 735
10 SASI_Rn02_00270134 predicted 1058
11 SASI_Rn01_00102867 predicted 231
12 SASI_Rn01_00102869 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170733 predicted 1291
2 SASI_Mm01_00170734 predicted 638
3 SASI_Mm01_00170735 predicted 1099
4 SASI_Mm01_00170736 predicted 399
5 SASI_Mm01_00170737 predicted 990
6 SASI_Mm01_00170738 predicted 277
7 SASI_Mm01_00170739 predicted 1113
8 SASI_Mm01_00170740 predicted 1301
9 SASI_Mm01_00170741 predicted 1309
10 SASI_Mm01_00170742 predicted 950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008690
VALIDATED
NFKBIE MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-678s21c1
Sequence:CCGGGGACATTCAGAACAACCTTTACTCGAGTAAAGGTTGTTCTGAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1121s21c1
Sequence:CCGGTTAACGGGTGCACACCTTTACCTCGAGGTAAAGGTGTGCACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1697s21c1
Sequence:CCGGGCGGTAGGCAAGCTTACTATCCTCGAGGATAGTAAGCTTGCCTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-956s21c1
Sequence:CCGGAGAGGAACCAACCGCTCATAGCTCGAGCTATGAGCGGTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-400s1c1
Sequence:CCGGCCAGAGAAAGAAGATGCGGATCTCGAGATCCGCATCTTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-1887s1c1
Sequence:CCGGGCCACCGCAAAGTTATCTAAACTCGAGTTTAGATAACTTTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-1254s1c1
Sequence:CCGGCCTCCTTTCTTATTTGCCCTTCTCGAGAAGGGCAAATAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-963s1c1
Sequence:CCGGCCAACCGCTCATAGAACTGTTCTCGAGAACAGTTCTATGAGCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-639s1c1
Sequence:CCGGGCTATTCTGTTGCTTGGCTTTCTCGAGAAAGCCAAGCAACAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008690
VALIDATED
NFKBIE MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-678s21c1
Sequence:CCGGGGACATTCAGAACAACCTTTACTCGAGTAAAGGTTGTTCTGAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1121s21c1
Sequence:CCGGTTAACGGGTGCACACCTTTACCTCGAGGTAAAGGTGTGCACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1697s21c1
Sequence:CCGGGCGGTAGGCAAGCTTACTATCCTCGAGGATAGTAAGCTTGCCTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-956s21c1
Sequence:CCGGAGAGGAACCAACCGCTCATAGCTCGAGCTATGAGCGGTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-400s1c1
Sequence:CCGGCCAGAGAAAGAAGATGCGGATCTCGAGATCCGCATCTTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-1887s1c1
Sequence:CCGGGCCACCGCAAAGTTATCTAAACTCGAGTTTAGATAACTTTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-1254s1c1
Sequence:CCGGCCTCCTTTCTTATTTGCCCTTCTCGAGAAGGGCAAATAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-963s1c1
Sequence:CCGGCCAACCGCTCATAGAACTGTTCTCGAGAACAGTTCTATGAGCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-639s1c1
Sequence:CCGGGCTATTCTGTTGCTTGGCTTTCTCGAGAAAGCCAAGCAACAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008690
VALIDATED
NFKBIE MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-678s21c1
Sequence:CCGGGGACATTCAGAACAACCTTTACTCGAGTAAAGGTTGTTCTGAATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1121s21c1
Sequence:CCGGTTAACGGGTGCACACCTTTACCTCGAGGTAAAGGTGTGCACCCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360655    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-1697s21c1
Sequence:CCGGGCGGTAGGCAAGCTTACTATCCTCGAGGATAGTAAGCTTGCCTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008690.3-956s21c1
Sequence:CCGGAGAGGAACCAACCGCTCATAGCTCGAGCTATGAGCGGTTGGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-400s1c1
Sequence:CCGGCCAGAGAAAGAAGATGCGGATCTCGAGATCCGCATCTTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067453    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-1887s1c1
Sequence:CCGGGCCACCGCAAAGTTATCTAAACTCGAGTTTAGATAACTTTGCGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-1254s1c1
Sequence:CCGGCCTCCTTTCTTATTTGCCCTTCTCGAGAAGGGCAAATAAGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008690.2-963s1c1
Sequence:CCGGCCAACCGCTCATAGAACTGTTCTCGAGAACAGTTCTATGAGCGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008690.2-639s1c1
Sequence:CCGGGCTATTCTGTTGCTTGGCTTTCTCGAGAAAGCCAAGCAACAGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004556
VALIDATED
NFKBIE MISSION shRNA Bacterial Glycerol Stock
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1194s21c1
Sequence:CCGGTTCGGAATGGAGCTGACATTGCTCGAGCAATGTCAGCTCCATTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-2019s21c1
Sequence:CCGGTTTCAGTAACATGACACTAAACTCGAGTTTAGTGTCATGTTACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004556.2-767s21c1
Sequence:CCGGCAGCTGGAAGCACTCACTTACCTCGAGGTAAGTGAGTGCTTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1920s21c1
Sequence:CCGGTGAGAGGTGTCCCATCTTATTCTCGAGAATAAGATGGGACACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1201s1c1
Sequence:CCGGCTTCGGAATGGAGCTGACATTCTCGAGAATGTCAGCTCCATTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1175s1c1
Sequence:CCGGAGAACCAACCACTCATGGAATCTCGAGATTCCATGAGTGGTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004556.1-490s1c1
Sequence:CCGGAGCCAGTACGACTCTGGCATTCTCGAGAATGCCAGAGTCGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1386s1c1
Sequence:CCGGCATCTCATCCACTCTGTGCAACTCGAGTTGCACAGAGTGGATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004556
VALIDATED
NFKBIE MISSION shRNA shRNA Plasmid DNA
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1194s21c1
Sequence:CCGGTTCGGAATGGAGCTGACATTGCTCGAGCAATGTCAGCTCCATTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-2019s21c1
Sequence:CCGGTTTCAGTAACATGACACTAAACTCGAGTTTAGTGTCATGTTACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004556.2-767s21c1
Sequence:CCGGCAGCTGGAAGCACTCACTTACCTCGAGGTAAGTGAGTGCTTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1920s21c1
Sequence:CCGGTGAGAGGTGTCCCATCTTATTCTCGAGAATAAGATGGGACACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1201s1c1
Sequence:CCGGCTTCGGAATGGAGCTGACATTCTCGAGAATGTCAGCTCCATTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1175s1c1
Sequence:CCGGAGAACCAACCACTCATGGAATCTCGAGATTCCATGAGTGGTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004556.1-490s1c1
Sequence:CCGGAGCCAGTACGACTCTGGCATTCTCGAGAATGCCAGAGTCGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1386s1c1
Sequence:CCGGCATCTCATCCACTCTGTGCAACTCGAGTTGCACAGAGTGGATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004556
VALIDATED
NFKBIE MISSION shRNA Lentiviral Transduction Particles
nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1194s21c1
Sequence:CCGGTTCGGAATGGAGCTGACATTGCTCGAGCAATGTCAGCTCCATTCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-2019s21c1
Sequence:CCGGTTTCAGTAACATGACACTAAACTCGAGTTTAGTGTCATGTTACTGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004556.2-767s21c1
Sequence:CCGGCAGCTGGAAGCACTCACTTACCTCGAGGTAAGTGAGTGCTTCCAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358895    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004556.2-1920s21c1
Sequence:CCGGTGAGAGGTGTCCCATCTTATTCTCGAGAATAAGATGGGACACCTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1201s1c1
Sequence:CCGGCTTCGGAATGGAGCTGACATTCTCGAGAATGTCAGCTCCATTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1175s1c1
Sequence:CCGGAGAACCAACCACTCATGGAATCTCGAGATTCCATGAGTGGTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_004556.1-490s1c1
Sequence:CCGGAGCCAGTACGACTCTGGCATTCTCGAGAATGCCAGAGTCGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004556.1-1386s1c1
Sequence:CCGGCATCTCATCCACTCTGTGCAACTCGAGTTGCACAGAGTGGATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks