EMAIL THIS PAGE TO A FRIEND

NFS1

NFS1 cysteine desulfurase

Synonyms: IscS NIFS
Gene ID:
Human(9054) Summary: Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]
Mouse(18041) nitrogen fixation gene 1 (S. cerevisiae)
Rat(84594) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
naked mole-rat(101724186) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Domestic Rabbit(100328709) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
domestic guinea pig(100733215) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
sheep(101118123) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Thale Cress(836701) cysteine desulfurase
cow(517656) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Horse(100054930) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
domestic cat(101100201) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
dog(477214) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
chicken(419133) NFS1 nitrogen fixation 1 homolog (S. cerevisiae)
Zebrafish(562714) NFS1 nitrogen fixation 1 (S. cerevisiae)
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021100 Rosetta Predictions human pricing
NM_181679 Rosetta Predictions human pricing
NM_053462 Rosetta Predictions rat pricing
NM_010911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083330 predicted 1506
2 SASI_Hs01_00083331 predicted 478
3 SASI_Hs01_00083332 predicted 1251
4 SASI_Hs01_00083334 predicted 1002
5 SASI_Hs02_00354584 predicted 476
6 SASI_Hs01_00083335 predicted 1406
7 SASI_Hs02_00354585 predicted 1258
8 SASI_Hs01_00083336 predicted 1280
9 SASI_Hs02_00354586 predicted 1003
10 SASI_Hs01_00083338 predicted 1234
11 SASI_Hs01_00083333 predicted 1259
12 SASI_Hs01_00083337 predicted 1386
13 SASI_Hs01_00083339 predicted 1534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224343 predicted 227
2 SASI_Hs01_00224344 predicted 239
3 SASI_Hs01_00224345 predicted 231
4 SASI_Hs01_00224346 predicted 229
5 SASI_Hs01_00224347 predicted 230
6 SASI_Hs01_00224348 predicted 229
7 SASI_Hs01_00224349 predicted 224
8 SASI_Hs01_00224350 predicted 369
9 SASI_Hs01_00224351 predicted 382
10 SASI_Hs01_00224352 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077805 predicted 1119
2 SASI_Rn01_00077806 predicted 1208
3 SASI_Rn02_00266042 predicted 1369
4 SASI_Rn01_00077808 predicted 404
5 SASI_Rn01_00077809 predicted 558
6 SASI_Rn02_00266043 predicted 418
7 SASI_Rn02_00266044 predicted 1211
8 SASI_Rn01_00077811 predicted 936
9 SASI_Rn01_00077812 predicted 969
10 SASI_Rn01_00077813 predicted 247
11 SASI_Rn01_00077807 predicted 625
12 SASI_Rn01_00077810 predicted 627
13 SASI_Rn01_00077814 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173316 predicted 222
2 SASI_Mm02_00319643 predicted 1207
3 SASI_Mm01_00173317 predicted 813
4 SASI_Mm01_00173318 predicted 653
5 SASI_Mm01_00173320 predicted 446
6 SASI_Mm01_00173321 predicted 1243
7 SASI_Mm01_00173322 predicted 595
8 SASI_Mm02_00319644 predicted 1210
9 SASI_Mm02_00319645 predicted 1449
10 SASI_Mm01_00173323 predicted 1240
11 SASI_Mm01_00173319 predicted 1211
12 SASI_Mm01_00173324 predicted 371
13 SASI_Mm01_00173325 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010911
VALIDATED
NFS1 MISSION shRNA Bacterial Glycerol Stock
NFS1 cysteine desulfurase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-1003s21c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010911.2-1600s21c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-287s21c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-968s21c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1599s1c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1002s1c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-286s1c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-967s1c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-591s1c1
Sequence:CCGGGAGCGGGATCATTGACTTAAACTCGAGTTTAAGTCAATGATCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010911
VALIDATED
NFS1 MISSION shRNA shRNA Plasmid DNA
NFS1 cysteine desulfurase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-1003s21c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010911.2-1600s21c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-287s21c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-968s21c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1599s1c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1002s1c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-286s1c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-967s1c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-591s1c1
Sequence:CCGGGAGCGGGATCATTGACTTAAACTCGAGTTTAAGTCAATGATCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010911
VALIDATED
NFS1 MISSION shRNA Lentiviral Transduction Particles
NFS1 cysteine desulfurase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-1003s21c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335459    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010911.2-1600s21c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-287s21c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010911.2-968s21c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1599s1c1
Sequence:CCGGGCTCCTGTGTAGGCATGTATTCTCGAGAATACATGCCTACACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-1002s1c1
Sequence:CCGGCGACCATAAGCGGATCTCAAACTCGAGTTTGAGATCCGCTTATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-286s1c1
Sequence:CCGGCCATACCTTGTCAACTACTATCTCGAGATAGTAGTTGACAAGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-967s1c1
Sequence:CCGGGCTGCATGTGAGTTGGCACAACTCGAGTTGTGCCAACTCACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010911.1-591s1c1
Sequence:CCGGGAGCGGGATCATTGACTTAAACTCGAGTTTAAGTCAATGATCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021100
VALIDATED
NFS1 MISSION shRNA Bacterial Glycerol Stock
NFS1 cysteine desulfurase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1044s21c1
Sequence:GTACCGGAGCGGCTGATACAGAATATAACTCGAGTTATATTCTGTATCAGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-2010s21c1
Sequence:CCGGCTGTGACTCCACCAGTTATTCCTCGAGGAATAACTGGTGGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1351s21c1
Sequence:CCGGTGTGAAGCGTCTTCGAGAAATCTCGAGATTTCTCGAAGACGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021100.3-1095s21c1
Sequence:CCGGGGGACCCTAAGCACCATTATCCTCGAGGATAATGGTGCTTAGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-730s21c1
Sequence:CCGGCAGTTCCAGAAAGGTATATTTCTCGAGAAATATACCTTTCTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-299s1c1
Sequence:CCGGCCTTACCTAATCAACTACTATCTCGAGATAGTAGTTGATTAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-1268s1c1
Sequence:CCGGGCGCACTCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021100.3-295s1c1
Sequence:CCGGGCTCCCTTACCTAATCAACTACTCGAGTAGTTGATTAGGTAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1018s1c1
Sequence:CCGGCCACAAGCGAATCTCAAAGTTCTCGAGAACTTTGAGATTCGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1227s1c1
Sequence:CCGGCCTCTTATGTGCTTAGAGCAACTCGAGTTGCTCTAAGCACATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-443s1c1
Sequence:CCGGGCTACTGAATCCAACAACATACTCGAGTATGTTGTTGGATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021100
VALIDATED
NFS1 MISSION shRNA shRNA Plasmid DNA
NFS1 cysteine desulfurase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1044s21c1
Sequence:GTACCGGAGCGGCTGATACAGAATATAACTCGAGTTATATTCTGTATCAGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-2010s21c1
Sequence:CCGGCTGTGACTCCACCAGTTATTCCTCGAGGAATAACTGGTGGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1351s21c1
Sequence:CCGGTGTGAAGCGTCTTCGAGAAATCTCGAGATTTCTCGAAGACGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021100.3-1095s21c1
Sequence:CCGGGGGACCCTAAGCACCATTATCCTCGAGGATAATGGTGCTTAGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-730s21c1
Sequence:CCGGCAGTTCCAGAAAGGTATATTTCTCGAGAAATATACCTTTCTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-299s1c1
Sequence:CCGGCCTTACCTAATCAACTACTATCTCGAGATAGTAGTTGATTAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-1268s1c1
Sequence:CCGGGCGCACTCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021100.3-295s1c1
Sequence:CCGGGCTCCCTTACCTAATCAACTACTCGAGTAGTTGATTAGGTAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1018s1c1
Sequence:CCGGCCACAAGCGAATCTCAAAGTTCTCGAGAACTTTGAGATTCGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1227s1c1
Sequence:CCGGCCTCTTATGTGCTTAGAGCAACTCGAGTTGCTCTAAGCACATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-443s1c1
Sequence:CCGGGCTACTGAATCCAACAACATACTCGAGTATGTTGTTGGATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021100
VALIDATED
NFS1 MISSION shRNA Lentiviral Transduction Particles
NFS1 cysteine desulfurase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1044s21c1
Sequence:GTACCGGAGCGGCTGATACAGAATATAACTCGAGTTATATTCTGTATCAGCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-2010s21c1
Sequence:CCGGCTGTGACTCCACCAGTTATTCCTCGAGGAATAACTGGTGGAGTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-1351s21c1
Sequence:CCGGTGTGAAGCGTCTTCGAGAAATCTCGAGATTTCTCGAAGACGCTTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021100.3-1095s21c1
Sequence:CCGGGGGACCCTAAGCACCATTATCCTCGAGGATAATGGTGCTTAGGGTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_021100.3-730s21c1
Sequence:CCGGCAGTTCCAGAAAGGTATATTTCTCGAGAAATATACCTTTCTGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-299s1c1
Sequence:CCGGCCTTACCTAATCAACTACTATCTCGAGATAGTAGTTGATTAGGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-1268s1c1
Sequence:CCGGGCGCACTCTTCTATCAGGTTTCTCGAGAAACCTGATAGAAGAGTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_021100.3-295s1c1
Sequence:CCGGGCTCCCTTACCTAATCAACTACTCGAGTAGTTGATTAGGTAAGGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1018s1c1
Sequence:CCGGCCACAAGCGAATCTCAAAGTTCTCGAGAACTTTGAGATTCGCTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178992    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021100.3-1227s1c1
Sequence:CCGGCCTCTTATGTGCTTAGAGCAACTCGAGTTGCTCTAAGCACATAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_021100.3-443s1c1
Sequence:CCGGGCTACTGAATCCAACAACATACTCGAGTATGTTGTTGGATTCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks