EMAIL THIS PAGE TO A FRIEND

NGDN

neuroguidin, EIF4E binding protein

Synonyms: C14orf120 LCP5 NGD lpd-2
UniProtKB ID: Q8NEJ9, A8K760, Q9Y400
Gene ID:
Human(25983) Summary: Neuroguidin is an EIF4E (MIM 133440)-binding protein that interacts with CPEB (MIM 607342) and functions as a translational regulatory protein during development of the vertebrate nervous system (Jung et al., 2006 [PubMed 16705177]
Mouse(68966) neuroguidin, EIF4E binding protein
Rat(305887) neuroguidin, EIF4E binding protein
naked mole-rat(101711635) neuroguidin, EIF4E binding protein
domestic guinea pig(100716385) neuroguidin, EIF4E binding protein
sheep(101119824) neuroguidin, EIF4E binding protein
Zebrafish(386642) neuroguidin, EIF4E binding protein
cow(539602) neuroguidin, EIF4E binding protein
domestic cat(101096239) neuroguidin, EIF4E binding protein
dog(490612) neuroguidin, EIF4E binding protein
177 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042635 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042635 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042635 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042635 Rosetta Predictions human pricing
NM_015514 Rosetta Predictions human pricing
XM_033371 Rosetta Predictions human pricing
XM_932887 Rosetta Predictions human pricing
XM_932891 Rosetta Predictions human pricing
XM_932893 Rosetta Predictions human pricing
XM_932894 Rosetta Predictions human pricing
XM_932898 Rosetta Predictions human pricing
XM_932900 Rosetta Predictions human pricing
XM_932903 Rosetta Predictions human pricing
XM_932906 Rosetta Predictions human pricing
NM_001107263 Rosetta Predictions rat pricing
NM_026890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042635 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310863 predicted 507
2 SASI_Hs02_00310864 predicted 545
3 SASI_Hs02_00310865 predicted 588
4 SASI_Hs02_00310866 predicted 423
5 SASI_Hs02_00310867 predicted 243
6 SASI_Hs02_00310868 predicted 314
7 SASI_Hs02_00310869 predicted 548
8 SASI_Hs02_00310870 predicted 197
9 SASI_Hs02_00310871 predicted 723
10 SASI_Hs02_00310872 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348000 predicted 510
2 SASI_Hs02_00348001 predicted 549
3 SASI_Hs02_00348002 predicted 581
4 SASI_Hs02_00348003 predicted 421
5 SASI_Hs02_00348004 predicted 241
6 SASI_Hs02_00348005 predicted 320
7 SASI_Hs02_00348006 predicted 542
8 SASI_Hs02_00348007 predicted 198
9 SASI_Hs02_00348008 predicted 722
10 SASI_Hs02_00348009 predicted 361
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_033371 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00250086 predicted 509
2 SASI_Hs01_00250087 predicted 547
3 SASI_Hs01_00250088 predicted 584
4 SASI_Hs01_00250089 predicted 813
5 SASI_Hs01_00250090 predicted 827
6 SASI_Hs01_00250091 predicted 742
7 SASI_Hs01_00250092 predicted 720
8 SASI_Hs01_00250093 predicted 651
9 SASI_Hs01_00250094 predicted 620
10 SASI_Hs01_00250095 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00259995 predicted 299
2 SASI_Hs01_00259996 predicted 457
3 SASI_Hs01_00259997 predicted 359
4 SASI_Hs01_00259998 predicted 292
5 SASI_Hs01_00259999 predicted 225
6 SASI_Hs01_00260000 predicted 285
7 SASI_Hs01_00260001 predicted 357
8 SASI_Hs01_00260002 predicted 348
9 SASI_Hs01_00260003 predicted 483
10 SASI_Hs01_00260004 predicted 431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268315 predicted 588
2 SASI_Hs01_00268316 predicted 512
3 SASI_Hs01_00268317 predicted 547
4 SASI_Hs01_00268318 predicted 578
5 SASI_Hs01_00268319 predicted 542
6 SASI_Hs01_00268320 predicted 649
7 SASI_Hs01_00268321 predicted 620
8 SASI_Hs01_00268322 predicted 649
9 SASI_Hs01_00268323 predicted 629
10 SASI_Hs01_00268324 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272258 predicted 232
2 SASI_Hs01_00272259 predicted 418
3 SASI_Hs01_00272260 predicted 310
4 SASI_Hs01_00272261 predicted 421
5 SASI_Hs01_00272262 predicted 355
6 SASI_Hs01_00272263 predicted 309
7 SASI_Hs01_00272264 predicted 357
8 SASI_Hs01_00272265 predicted 331
9 SASI_Hs01_00272266 predicted 472
10 SASI_Hs01_00272267 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00279322 predicted 291
2 SASI_Hs01_00279323 predicted 66
3 SASI_Hs01_00279324 predicted 444
4 SASI_Hs01_00279325 predicted 347
5 SASI_Hs01_00279326 predicted 84
6 SASI_Hs01_00279327 predicted 125
7 SASI_Hs01_00279328 predicted 286
8 SASI_Hs01_00279329 predicted 222
9 SASI_Hs01_00279330 predicted 547
10 SASI_Hs01_00279331 predicted 179
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261868 predicted 594
2 SASI_Hs01_00261869 predicted 508
3 SASI_Hs01_00261870 predicted 544
4 SASI_Hs01_00261871 predicted 581
5 SASI_Hs01_00261872 predicted 541
6 SASI_Hs01_00261873 predicted 647
7 SASI_Hs01_00261874 predicted 630
8 SASI_Hs01_00261875 predicted 647
9 SASI_Hs01_00261876 predicted 632
10 SASI_Hs01_00261877 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932900 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257958 predicted 588
2 SASI_Hs01_00257959 predicted 506
3 SASI_Hs01_00257960 predicted 544
4 SASI_Hs01_00257961 predicted 587
5 SASI_Hs01_00257962 predicted 540
6 SASI_Hs01_00257963 predicted 725
7 SASI_Hs01_00257964 predicted 654
8 SASI_Hs01_00257965 predicted 621
9 SASI_Hs01_00257966 predicted 649
10 SASI_Hs01_00257967 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276684 predicted 592
2 SASI_Hs01_00276685 predicted 509
3 SASI_Hs01_00276686 predicted 538
4 SASI_Hs01_00276687 predicted 579
5 SASI_Hs01_00276688 predicted 549
6 SASI_Hs01_00276689 predicted 723
7 SASI_Hs01_00276690 predicted 654
8 SASI_Hs01_00276691 predicted 624
9 SASI_Hs01_00276692 predicted 647
10 SASI_Hs01_00276693 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_932906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00265558 predicted 759
2 SASI_Hs01_00265559 predicted 794
3 SASI_Hs01_00265560 predicted 842
4 SASI_Hs01_00265561 predicted 1070
5 SASI_Hs01_00265562 predicted 1081
6 SASI_Hs01_00265563 predicted 997
7 SASI_Hs01_00265564 predicted 983
8 SASI_Hs01_00265565 predicted 902
9 SASI_Hs01_00265566 predicted 884
10 SASI_Hs01_00265567 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227115 predicted 562
2 SASI_Rn02_00227116 predicted 452
3 SASI_Rn02_00227117 predicted 317
4 SASI_Rn02_00227118 predicted 414
5 SASI_Rn02_00227119 predicted 350
6 SASI_Rn02_00227120 predicted 598
7 SASI_Rn02_00227121 predicted 963
8 SASI_Rn02_00227122 predicted 774
9 SASI_Rn02_00227123 predicted 497
10 SASI_Rn02_00227124 predicted 779
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107611 predicted 579
2 SASI_Mm01_00107612 predicted 354
3 SASI_Mm01_00107613 predicted 319
4 SASI_Mm01_00107614 predicted 456
5 SASI_Mm01_00107615 predicted 847
6 SASI_Mm01_00107616 predicted 508
7 SASI_Mm02_00331151 predicted 388
8 SASI_Mm01_00107617 predicted 778
9 SASI_Mm01_00107618 predicted 285
10 SASI_Mm01_00107620 predicted 587
11 SASI_Mm01_00107619 predicted 475
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026890
VALIDATED
NGDN MISSION shRNA Bacterial Glycerol Stock
neuroguidin, EIF4E binding protein
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000267460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-235s21c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-583s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-765s21c1
Sequence:CCGGATCAGCACAGGGTCAACTATGCTCGAGCATAGTTGACCCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-235s1c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-87s21c1
Sequence:CCGGCAGACGTGTCAAGTTCGATAACTCGAGTTATCGAACTTGACACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-790s21c1
Sequence:CCGGGAGCATGATGGTGCGCTTAAGCTCGAGCTTAAGCGCACCATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-764s1c1
Sequence:CCGGGATCAGCACAGGGTCAACTATCTCGAGATAGTTGACCCTGTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026890
VALIDATED
NGDN MISSION shRNA shRNA Plasmid DNA
neuroguidin, EIF4E binding protein
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000267460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-235s21c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-583s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-765s21c1
Sequence:CCGGATCAGCACAGGGTCAACTATGCTCGAGCATAGTTGACCCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-235s1c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-87s21c1
Sequence:CCGGCAGACGTGTCAAGTTCGATAACTCGAGTTATCGAACTTGACACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-790s21c1
Sequence:CCGGGAGCATGATGGTGCGCTTAAGCTCGAGCTTAAGCGCACCATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-764s1c1
Sequence:CCGGGATCAGCACAGGGTCAACTATCTCGAGATAGTTGACCCTGTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026890
VALIDATED
NGDN MISSION shRNA Lentiviral Transduction Particles
neuroguidin, EIF4E binding protein
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000267460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-235s21c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-583s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-765s21c1
Sequence:CCGGATCAGCACAGGGTCAACTATGCTCGAGCATAGTTGACCCTGTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-235s1c1
Sequence:CCGGGCTGTTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-87s21c1
Sequence:CCGGCAGACGTGTCAAGTTCGATAACTCGAGTTATCGAACTTGACACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026890.1-790s21c1
Sequence:CCGGGAGCATGATGGTGCGCTTAAGCTCGAGCTTAAGCGCACCATCATGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026890.1-764s1c1
Sequence:CCGGGATCAGCACAGGGTCAACTATCTCGAGATAGTTGACCCTGTGCTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042635
VALIDATED
NGDN MISSION shRNA Bacterial Glycerol Stock
neuroguidin, EIF4E binding protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042635.1-549s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-417s21c1
Sequence:CCGGTAAGCCTCATCCCAGCAATATCTCGAGATATTGCTGGGATGAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-766s21c1
Sequence:CCGGGTGCGTTTGAGCGTCAGTAAGCTCGAGCTTACTGACGCTCAAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-201s21c1
Sequence:CCGGGCTGCTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-727s21c1
Sequence:CCGGGAGGACCAACACAGGATTAACCTCGAGGTTAATCCTGTGTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042635
VALIDATED
NGDN MISSION shRNA shRNA Plasmid DNA
neuroguidin, EIF4E binding protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042635.1-549s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-417s21c1
Sequence:CCGGTAAGCCTCATCCCAGCAATATCTCGAGATATTGCTGGGATGAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-766s21c1
Sequence:CCGGGTGCGTTTGAGCGTCAGTAAGCTCGAGCTTACTGACGCTCAAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-201s21c1
Sequence:CCGGGCTGCTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-727s21c1
Sequence:CCGGGAGGACCAACACAGGATTAACCTCGAGGTTAATCCTGTGTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042635
VALIDATED
NGDN MISSION shRNA Lentiviral Transduction Particles
neuroguidin, EIF4E binding protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001042635.1-549s21c1
Sequence:CCGGACGCTTGGTTCCAGTACATTACTCGAGTAATGTACTGGAACCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-417s21c1
Sequence:CCGGTAAGCCTCATCCCAGCAATATCTCGAGATATTGCTGGGATGAGGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-766s21c1
Sequence:CCGGGTGCGTTTGAGCGTCAGTAAGCTCGAGCTTACTGACGCTCAAACGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-201s21c1
Sequence:CCGGGCTGCTGCTCATGTACCTTATCTCGAGATAAGGTACATGAGCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001042635.1-727s21c1
Sequence:CCGGGAGGACCAACACAGGATTAACCTCGAGGTTAATCCTGTGTTGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks