EMAIL THIS PAGE TO A FRIEND

NGRN

neugrin, neurite outgrowth associated

Synonyms: DSC92
UniProtKB ID: Q9NPE2, B2R6M8, Q4V9L7, Q9HBL4
Gene ID:
Mouse(83485) neugrin, neurite outgrowth associated
Rat(499191) neugrin, neurite outgrowth associated
dog(100684886) neugrin, neurite outgrowth associated
cow(508115) neugrin, neurite outgrowth associated
domestic cat(101081549) neugrin, neurite outgrowth associated
domestic guinea pig(100725864) neugrin, neurite outgrowth associated
naked mole-rat(101712392) neugrin, neurite outgrowth associated
sheep(101105603) neugrin, neurite outgrowth associated
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016645 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016645 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016645 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031375 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031375 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031375 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007741 MISSION® esiRNA esiRNA targeting mouse Ngrn (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033088 Rosetta Predictions human pricing
NM_016645 Rosetta Predictions human pricing
NM_001033900 Rosetta Predictions rat pricing
NM_031375 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046248 predicted 993
2 SASI_Hs01_00046249 predicted 901
3 SASI_Hs01_00046250 predicted 953
4 SASI_Hs01_00046251 predicted 897
5 SASI_Hs01_00046254 predicted 993
6 SASI_Hs01_00046255 predicted 1003
7 SASI_Hs01_00046257 predicted 735
8 SASI_Hs02_00308005 predicted 551
9 SASI_Hs02_00308006 predicted 583
10 SASI_Hs02_00308007 predicted 749
11 SASI_Hs01_00046252 predicted 845
12 SASI_Hs01_00046253 predicted 850
13 SASI_Hs01_00046256 predicted 881
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016645 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226035 predicted 1406
2 SASI_Hs01_00226036 predicted 1306
3 SASI_Hs01_00226037 predicted 1360
4 SASI_Hs01_00226038 predicted 1311
5 SASI_Hs01_00226041 predicted 1407
6 SASI_Hs01_00226042 predicted 1422
7 SASI_Hs01_00226044 predicted 1149
8 SASI_Hs02_00349814 predicted 965
9 SASI_Hs02_00349815 predicted 995
10 SASI_Hs02_00349816 predicted 1158
11 SASI_Hs01_00226039 predicted 1256
12 SASI_Hs01_00226040 predicted 1256
13 SASI_Hs01_00226043 predicted 1298
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030754 predicted 289
2 SASI_Rn01_00030755 predicted 878
3 SASI_Rn01_00030756 predicted 368
4 SASI_Rn01_00030757 predicted 703
5 SASI_Rn01_00030758 predicted 601
6 SASI_Rn01_00030759 predicted 361
7 SASI_Rn01_00030760 predicted 823
8 SASI_Rn01_00030761 predicted 559
9 SASI_Rn01_00030763 predicted 518
10 SASI_Rn02_00203807 predicted 478
11 SASI_Rn01_00030762 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031375 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152444 predicted 710
2 SASI_Mm01_00152446 predicted 1453
3 SASI_Mm01_00152447 predicted 1271
4 SASI_Mm01_00152448 predicted 1392
5 SASI_Mm01_00152449 predicted 1406
6 SASI_Mm01_00152450 predicted 779
7 SASI_Mm01_00152452 predicted 700
8 SASI_Mm01_00152453 predicted 1238
9 SASI_Mm02_00337116 predicted 765
10 SASI_Mm02_00337117 predicted 681
11 SASI_Mm01_00152445 predicted 738
12 SASI_Mm01_00152451 predicted 1371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016645
NGRN MISSION shRNA Bacterial Glycerol Stock
neugrin, neurite outgrowth associated
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-740s1c1
Sequence:CCGGGAAGGCTTTGATGTCAGCACTCTCGAGAGTGCTGACATCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1267s1c1
Sequence:CCGGCGGGAACTTCCTGTACAGAATCTCGAGATTCTGTACAGGAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1211s1c1
Sequence:CCGGCCAGATAACTTCAGCAGCAAACTCGAGTTTGCTGCTGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.2-723s1c1
Sequence:CCGGATGGAGCAGATACGGTATTTACTCGAGTAAATACCGTATCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016645.2-1479s1c1
Sequence:CCGGGCTGCGTGGATAGATTCAAACCTCGAGGTTTGAATCTATCCACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016645
NGRN MISSION shRNA shRNA Plasmid DNA
neugrin, neurite outgrowth associated
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-740s1c1
Sequence:CCGGGAAGGCTTTGATGTCAGCACTCTCGAGAGTGCTGACATCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1267s1c1
Sequence:CCGGCGGGAACTTCCTGTACAGAATCTCGAGATTCTGTACAGGAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1211s1c1
Sequence:CCGGCCAGATAACTTCAGCAGCAAACTCGAGTTTGCTGCTGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.2-723s1c1
Sequence:CCGGATGGAGCAGATACGGTATTTACTCGAGTAAATACCGTATCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016645.2-1479s1c1
Sequence:CCGGGCTGCGTGGATAGATTCAAACCTCGAGGTTTGAATCTATCCACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016645
NGRN MISSION shRNA Lentiviral Transduction Particles
neugrin, neurite outgrowth associated
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172883    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-740s1c1
Sequence:CCGGGAAGGCTTTGATGTCAGCACTCTCGAGAGTGCTGACATCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1267s1c1
Sequence:CCGGCGGGAACTTCCTGTACAGAATCTCGAGATTCTGTACAGGAAGTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.1-1211s1c1
Sequence:CCGGCCAGATAACTTCAGCAGCAAACTCGAGTTTGCTGCTGAAGTTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219778    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016645.2-723s1c1
Sequence:CCGGATGGAGCAGATACGGTATTTACTCGAGTAAATACCGTATCTGCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219779    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016645.2-1479s1c1
Sequence:CCGGGCTGCGTGGATAGATTCAAACCTCGAGGTTTGAATCTATCCACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031375
VALIDATED
NGRN MISSION shRNA Bacterial Glycerol Stock
neugrin, neurite outgrowth associated
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1535s1c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-711s1c1
Sequence:CCGGCCGGTATTTACATAAGGAATTCTCGAGAATTCCTTATGTAAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-782s1c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1178s1c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1275s1c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031375.3-1534s21c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1274s21c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-781s21c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1177s21c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031375
VALIDATED
NGRN MISSION shRNA shRNA Plasmid DNA
neugrin, neurite outgrowth associated
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1535s1c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-711s1c1
Sequence:CCGGCCGGTATTTACATAAGGAATTCTCGAGAATTCCTTATGTAAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-782s1c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1178s1c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1275s1c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031375.3-1534s21c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1274s21c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-781s21c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1177s21c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031375
VALIDATED
NGRN MISSION shRNA Lentiviral Transduction Particles
neugrin, neurite outgrowth associated
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1535s1c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-711s1c1
Sequence:CCGGCCGGTATTTACATAAGGAATTCTCGAGAATTCCTTATGTAAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-782s1c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1178s1c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031375.2-1275s1c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031375.3-1534s21c1
Sequence:CCGGCTCTCTGTTGAGAACAAGAATCTCGAGATTCTTGTTCTCAACAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1274s21c1
Sequence:CCGGGCATGACTTCTTTGACAGCAACTCGAGTTGCTGTCAAAGAAGTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-781s21c1
Sequence:CCGGCTGATGTTATCCGAAGGGTTTCTCGAGAAACCCTTCGGATAACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031375.3-1177s21c1
Sequence:CCGGCTGGCAGTGATACGTTACCAACTCGAGTTGGTAACGTATCACTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks