EMAIL THIS PAGE TO A FRIEND

NHLRC2

NHL repeat containing 2

UniProtKB ID: Q8NBF2, Q8N1H1, Q8N5A6
Gene ID:
Mouse(66866) NHL repeat containing 2
Rat(307986) NHL repeat containing 2
domestic guinea pig(100716475) NHL repeat containing 2
naked mole-rat(101707646) NHL repeat containing 2
sheep(101123514) NHL repeat containing 2
Zebrafish(100535163) NHL repeat containing 2
cow(534327) NHL repeat containing 2
Horse(100059070) NHL repeat containing 2
domestic cat(101081416) NHL repeat containing 2
dog(486897) NHL repeat containing 2
chicken(423903) NHL repeat containing 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198514 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198514 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198514 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044631 MISSION® esiRNA esiRNA targeting mouse Nhlrc2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198514 Rosetta Predictions human pricing
NM_001107444 Rosetta Predictions rat pricing
NM_025811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198514 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234151 predicted 404
2 SASI_Hs01_00234152 predicted 2185
3 SASI_Hs02_00372091 predicted 1178
4 SASI_Hs01_00234153 predicted 1974
5 SASI_Hs01_00234154 predicted 708
6 SASI_Hs01_00234155 predicted 2238
7 SASI_Hs01_00234156 predicted 1392
8 SASI_Hs02_00372092 predicted 894
9 SASI_Hs01_00234157 predicted 968
10 SASI_Hs02_00372093 predicted 2206
11 SASI_Hs01_00234158 predicted 2146
12 SASI_Hs01_00234159 predicted 362
13 SASI_Hs01_00234160 predicted 1614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107444 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228885 predicted 773
2 SASI_Rn02_00228886 predicted 2335
3 SASI_Rn02_00228887 predicted 1202
4 SASI_Rn02_00228888 predicted 2048
5 SASI_Rn02_00228889 predicted 647
6 SASI_Rn02_00228890 predicted 1611
7 SASI_Rn02_00228891 predicted 2687
8 SASI_Rn02_00228892 predicted 1340
9 SASI_Rn02_00228893 predicted 2648
10 SASI_Rn02_00228894 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196400 predicted 1609
2 SASI_Mm01_00196401 predicted 1372
3 SASI_Mm01_00196402 predicted 1621
4 SASI_Mm01_00196403 predicted 2061
5 SASI_Mm01_00196404 predicted 1912
6 SASI_Mm01_00196405 predicted 1080
7 SASI_Mm01_00196406 predicted 1203
8 SASI_Mm01_00196407 predicted 989
9 SASI_Mm01_00196408 predicted 884
10 SASI_Mm02_00329053 predicted 1596
11 SASI_Mm01_00196399 predicted 1025
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198514
VALIDATED
NHLRC2 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-403s21c1
Sequence:CCGGTGAACACAGAAGAACCTATTTCTCGAGAAATAGGTTCTTCTGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-1681s21c1
Sequence:CCGGATGTTGCAGACTCCTACAATCCTCGAGGATTGTAGGAGTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-2220s21c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-911s21c1
Sequence:CCGGAGTTACTGATAGATTGGTAATCTCGAGATTACCAATCTATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-1052s21c1
Sequence:CCGGTCCACAGGGTGTAGCCATAATCTCGAGATTATGGCTACACCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-571s1c1
Sequence:CCGGCGGCTAAGTTTCCAAATGAAACTCGAGTTTCATTTGGAAACTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198514.2-2220s1c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-866s1c1
Sequence:CCGGGCCACCTTCACCATTGCTATTCTCGAGAATAGCAATGGTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-642s1c1
Sequence:CCGGCCTATGGTTAATGATGCAGATCTCGAGATCTGCATCATTAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198514
VALIDATED
NHLRC2 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-403s21c1
Sequence:CCGGTGAACACAGAAGAACCTATTTCTCGAGAAATAGGTTCTTCTGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-1681s21c1
Sequence:CCGGATGTTGCAGACTCCTACAATCCTCGAGGATTGTAGGAGTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-2220s21c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-911s21c1
Sequence:CCGGAGTTACTGATAGATTGGTAATCTCGAGATTACCAATCTATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-1052s21c1
Sequence:CCGGTCCACAGGGTGTAGCCATAATCTCGAGATTATGGCTACACCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-571s1c1
Sequence:CCGGCGGCTAAGTTTCCAAATGAAACTCGAGTTTCATTTGGAAACTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198514.2-2220s1c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-866s1c1
Sequence:CCGGGCCACCTTCACCATTGCTATTCTCGAGAATAGCAATGGTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-642s1c1
Sequence:CCGGCCTATGGTTAATGATGCAGATCTCGAGATCTGCATCATTAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198514
VALIDATED
NHLRC2 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-403s21c1
Sequence:CCGGTGAACACAGAAGAACCTATTTCTCGAGAAATAGGTTCTTCTGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198514.2-1681s21c1
Sequence:CCGGATGTTGCAGACTCCTACAATCCTCGAGGATTGTAGGAGTCTGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299817    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-2220s21c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-911s21c1
Sequence:CCGGAGTTACTGATAGATTGGTAATCTCGAGATTACCAATCTATCAGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_198514.2-1052s21c1
Sequence:CCGGTCCACAGGGTGTAGCCATAATCTCGAGATTATGGCTACACCCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-571s1c1
Sequence:CCGGCGGCTAAGTTTCCAAATGAAACTCGAGTTTCATTTGGAAACTTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_198514.2-2220s1c1
Sequence:CCGGCCTGATGATTGCTTATCACTTCTCGAGAAGTGATAAGCAATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-866s1c1
Sequence:CCGGGCCACCTTCACCATTGCTATTCTCGAGAATAGCAATGGTGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198514.2-642s1c1
Sequence:CCGGCCTATGGTTAATGATGCAGATCTCGAGATCTGCATCATTAACCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025811
VALIDATED
NHLRC2 MISSION shRNA Bacterial Glycerol Stock
NHL repeat containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025811.3-2775s1c1
Sequence:CCGGCCAAGTCATTGACCATCATTTCTCGAGAAATGATGGTCAATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-677s1c1
Sequence:CCGGCTTCACCTACTGCTGCATAAACTCGAGTTTATGCAGCAGTAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-1305s1c1
Sequence:CCGGGACACTGAGAACCACCTTATACTCGAGTATAAGGTGGTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025811.1-1155s1c1
Sequence:CCGGGCACCATAGGATCTTGGTCATCTCGAGATGACCAAGATCCTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.1-2421s1c1
Sequence:CCGGGCAGATTCCTACCCATTGCTTCTCGAGAAGCAATGGGTAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-853s1c1
Sequence:CCGGCCTGTGGTTAACGATGCAGATCTCGAGATCTGCATCGTTAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025811.1-2845s1c1
Sequence:CCGGCCATGCTATATCAGAGAGTATCTCGAGATACTCTCTGATATAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-1899s1c1
Sequence:CCGGCGACTCCTACAATCACAAGATCTCGAGATCTTGTGATTGTAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025811
VALIDATED
NHLRC2 MISSION shRNA shRNA Plasmid DNA
NHL repeat containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025811.3-2775s1c1
Sequence:CCGGCCAAGTCATTGACCATCATTTCTCGAGAAATGATGGTCAATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-677s1c1
Sequence:CCGGCTTCACCTACTGCTGCATAAACTCGAGTTTATGCAGCAGTAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-1305s1c1
Sequence:CCGGGACACTGAGAACCACCTTATACTCGAGTATAAGGTGGTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025811.1-1155s1c1
Sequence:CCGGGCACCATAGGATCTTGGTCATCTCGAGATGACCAAGATCCTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.1-2421s1c1
Sequence:CCGGGCAGATTCCTACCCATTGCTTCTCGAGAAGCAATGGGTAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-853s1c1
Sequence:CCGGCCTGTGGTTAACGATGCAGATCTCGAGATCTGCATCGTTAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025811.1-2845s1c1
Sequence:CCGGCCATGCTATATCAGAGAGTATCTCGAGATACTCTCTGATATAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-1899s1c1
Sequence:CCGGCGACTCCTACAATCACAAGATCTCGAGATCTTGTGATTGTAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025811
VALIDATED
NHLRC2 MISSION shRNA Lentiviral Transduction Particles
NHL repeat containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217782    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025811.3-2775s1c1
Sequence:CCGGCCAAGTCATTGACCATCATTTCTCGAGAAATGATGGTCAATGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217826    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-677s1c1
Sequence:CCGGCTTCACCTACTGCTGCATAAACTCGAGTTTATGCAGCAGTAGGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.3-1305s1c1
Sequence:CCGGGACACTGAGAACCACCTTATACTCGAGTATAAGGTGGTTCTCAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025811.1-1155s1c1
Sequence:CCGGGCACCATAGGATCTTGGTCATCTCGAGATGACCAAGATCCTATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025811.1-2421s1c1
Sequence:CCGGGCAGATTCCTACCCATTGCTTCTCGAGAAGCAATGGGTAGGAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-853s1c1
Sequence:CCGGCCTGTGGTTAACGATGCAGATCTCGAGATCTGCATCGTTAACCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183106    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025811.1-2845s1c1
Sequence:CCGGCCATGCTATATCAGAGAGTATCTCGAGATACTCTCTGATATAGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025811.1-1899s1c1
Sequence:CCGGCGACTCCTACAATCACAAGATCTCGAGATCTTGTGATTGTAGGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks