EMAIL THIS PAGE TO A FRIEND

NICN1

nicolin 1

UniProtKB ID: Q9BSH3, Q8IZQ2
Gene ID:
Human(84276) Summary: This protein encoded by this gene localizes to the nucleus and is expressed in numerous tissues including brain, testis, liver, and kidney. This refseq contains genomic sequence in its 3' UTR which is not supported by experimental evidence. Computer predictions indicate that this region of the 3' UTR contains hairpin-forming self-complementary sequence which is possibly excised after transcription. This gene has a pseudogene on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(66257) nicolin 1
Rat(619581) nicolin 1
Zebrafish(445216) nicolin 1
dog(608810) nicolin 1
cow(614730) nicolin 1
sheep(101104016) nicolin 1
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025449 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025449 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025449 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032316 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032316 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032316 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032316 Rosetta Predictions human pricing
NM_001034999 Rosetta Predictions rat pricing
NM_025449 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032316 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359671 predicted 425
2 SASI_Hs01_00047780 predicted 211
3 SASI_Hs01_00047781 predicted 363
4 SASI_Hs01_00047782 predicted 971
5 SASI_Hs01_00047783 predicted 686
6 SASI_Hs01_00047784 predicted 1095
7 SASI_Hs01_00047785 predicted 669
8 SASI_Hs01_00047786 predicted 848
9 SASI_Hs01_00047787 predicted 1021
10 SASI_Hs01_00047789 predicted 480
11 SASI_Hs01_00047788 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113238 predicted 889
2 SASI_Rn02_00204166 predicted 620
3 SASI_Rn01_00113239 predicted 637
4 SASI_Rn01_00113240 predicted 1035
5 SASI_Rn01_00113241 predicted 944
6 SASI_Rn01_00113242 predicted 661
7 SASI_Rn01_00113243 predicted 606
8 SASI_Rn01_00113244 predicted 933
9 SASI_Rn01_00113245 predicted 842
10 SASI_Rn01_00113246 predicted 822
11 SASI_Rn01_00113247 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025449 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158519 predicted 679
2 SASI_Mm01_00158520 predicted 351
3 SASI_Mm01_00158521 predicted 206
4 SASI_Mm01_00158522 predicted 287
5 SASI_Mm01_00158523 predicted 243
6 SASI_Mm02_00328278 predicted 733
7 SASI_Mm02_00328279 predicted 724
8 SASI_Mm01_00158524 predicted 1036
9 SASI_Mm01_00158525 predicted 816
10 SASI_Mm01_00158527 predicted 667
11 SASI_Mm01_00158526 predicted 794
12 SASI_Mm01_00158528 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025449
VALIDATED
NICN1 MISSION shRNA Bacterial Glycerol Stock
nicolin 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-296s21c1
Sequence:CCGGGGTAACTTGTCTTCGGGATTACTCGAGTAATCCCGAAGACAAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-210s21c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025449.3-1087s21c1
Sequence:CCGGGAGGAAGACATACCCTCTATTCTCGAGAATAGAGGGTATGTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-678s21c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-251s21c1
Sequence:CCGGCATCCGTGTTCGTCAACAAAGCTCGAGCTTTGTTGACGAACACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-209s1c1
Sequence:CCGGGCAGGAGATCATGTTTAAGAACTCGAGTTCTTAAACATGATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-210s1c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025449.2-678s1c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-204s1c1
Sequence:CCGGGAGTTGCAGGAGATCATGTTTCTCGAGAAACATGATCTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025449
VALIDATED
NICN1 MISSION shRNA shRNA Plasmid DNA
nicolin 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-296s21c1
Sequence:CCGGGGTAACTTGTCTTCGGGATTACTCGAGTAATCCCGAAGACAAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-210s21c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025449.3-1087s21c1
Sequence:CCGGGAGGAAGACATACCCTCTATTCTCGAGAATAGAGGGTATGTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-678s21c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-251s21c1
Sequence:CCGGCATCCGTGTTCGTCAACAAAGCTCGAGCTTTGTTGACGAACACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-209s1c1
Sequence:CCGGGCAGGAGATCATGTTTAAGAACTCGAGTTCTTAAACATGATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-210s1c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025449.2-678s1c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-204s1c1
Sequence:CCGGGAGTTGCAGGAGATCATGTTTCTCGAGAAACATGATCTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025449
VALIDATED
NICN1 MISSION shRNA Lentiviral Transduction Particles
nicolin 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-296s21c1
Sequence:CCGGGGTAACTTGTCTTCGGGATTACTCGAGTAATCCCGAAGACAAGTTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-210s21c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276746    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025449.3-1087s21c1
Sequence:CCGGGAGGAAGACATACCCTCTATTCTCGAGAATAGAGGGTATGTCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-678s21c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025449.3-251s21c1
Sequence:CCGGCATCCGTGTTCGTCAACAAAGCTCGAGCTTTGTTGACGAACACGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-209s1c1
Sequence:CCGGGCAGGAGATCATGTTTAAGAACTCGAGTTCTTAAACATGATCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-210s1c1
Sequence:CCGGCAGGAGATCATGTTTAAGAATCTCGAGATTCTTAAACATGATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025449.2-678s1c1
Sequence:CCGGGATGGCTGTTATGATCTGAATCTCGAGATTCAGATCATAACAGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025449.2-204s1c1
Sequence:CCGGGAGTTGCAGGAGATCATGTTTCTCGAGAAACATGATCTCCTGCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032316
VALIDATED
NICN1 MISSION shRNA Bacterial Glycerol Stock
nicolin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-761s1c1
Sequence:CCGGGAAGTGTATTTCCTGTGCATTCTCGAGAATGCACAGGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032316.2-1346s1c1
Sequence:CCGGCCTGAGCATAAGAACTGGGATCTCGAGATCCCAGTTCTTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-181s1c1
Sequence:CCGGGTTGCAGGAAATCACGTTTAACTCGAGTTAAACGTGATTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-904s1c1
Sequence:CCGGGCAACTCAATTCTTCCTTCTACTCGAGTAGAAGGAAGAATTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-1403s1c1
Sequence:CCGGCCAAGAGATATGCTCAGCATACTCGAGTATGCTGAGCATATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-332s1c1
Sequence:CCGGGAGTATGTATCGCTGTTCAAGCTCGAGCTTGAACAGCGATACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-897s1c1
Sequence:CCGGCCTGGCTGCAACTCAATTCTTCTCGAGAAGAATTGAGTTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-668s1c1
Sequence:CCGGCTGAACTTGCTCTCCTACACTCTCGAGAGTGTAGGAGAGCAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-642s1c1
Sequence:CCGGGCTTTGATGTGGATGGCTGTTCTCGAGAACAGCCATCCACATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032316
VALIDATED
NICN1 MISSION shRNA shRNA Plasmid DNA
nicolin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-761s1c1
Sequence:CCGGGAAGTGTATTTCCTGTGCATTCTCGAGAATGCACAGGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032316.2-1346s1c1
Sequence:CCGGCCTGAGCATAAGAACTGGGATCTCGAGATCCCAGTTCTTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-181s1c1
Sequence:CCGGGTTGCAGGAAATCACGTTTAACTCGAGTTAAACGTGATTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-904s1c1
Sequence:CCGGGCAACTCAATTCTTCCTTCTACTCGAGTAGAAGGAAGAATTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-1403s1c1
Sequence:CCGGCCAAGAGATATGCTCAGCATACTCGAGTATGCTGAGCATATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-332s1c1
Sequence:CCGGGAGTATGTATCGCTGTTCAAGCTCGAGCTTGAACAGCGATACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-897s1c1
Sequence:CCGGCCTGGCTGCAACTCAATTCTTCTCGAGAAGAATTGAGTTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-668s1c1
Sequence:CCGGCTGAACTTGCTCTCCTACACTCTCGAGAGTGTAGGAGAGCAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-642s1c1
Sequence:CCGGGCTTTGATGTGGATGGCTGTTCTCGAGAACAGCCATCCACATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032316
VALIDATED
NICN1 MISSION shRNA Lentiviral Transduction Particles
nicolin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-761s1c1
Sequence:CCGGGAAGTGTATTTCCTGTGCATTCTCGAGAATGCACAGGAAATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032316.2-1346s1c1
Sequence:CCGGCCTGAGCATAAGAACTGGGATCTCGAGATCCCAGTTCTTATGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-181s1c1
Sequence:CCGGGTTGCAGGAAATCACGTTTAACTCGAGTTAAACGTGATTTCCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122149    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-904s1c1
Sequence:CCGGGCAACTCAATTCTTCCTTCTACTCGAGTAGAAGGAAGAATTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-1403s1c1
Sequence:CCGGCCAAGAGATATGCTCAGCATACTCGAGTATGCTGAGCATATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-332s1c1
Sequence:CCGGGAGTATGTATCGCTGTTCAAGCTCGAGCTTGAACAGCGATACATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141444    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032316.2-897s1c1
Sequence:CCGGCCTGGCTGCAACTCAATTCTTCTCGAGAAGAATTGAGTTGCAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-668s1c1
Sequence:CCGGCTGAACTTGCTCTCCTACACTCTCGAGAGTGTAGGAGAGCAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_032316.2-642s1c1
Sequence:CCGGGCTTTGATGTGGATGGCTGTTCTCGAGAACAGCCATCCACATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks