EMAIL THIS PAGE TO A FRIEND

NID2

nidogen 2 (osteonidogen)

Synonyms: NID-2
UniProtKB ID: Q14112, A8K6I7, B4DU19, O43710
Gene ID:
Human(22795) Summary: This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.[provided by RefSeq, Jun 2010]
Mouse(18074) nidogen 2
Rat(302248) nidogen 2 (osteonidogen)
chicken(423583) nidogen 2 (osteonidogen)
dog(480322) nidogen 2 (osteonidogen)
domestic cat(101090114) nidogen 2 (osteonidogen)
cow(521854) nidogen 2 (osteonidogen)
sheep(101107101) nidogen 2 (osteonidogen)
domestic guinea pig(100721714) nidogen 2 (osteonidogen)
naked mole-rat(101718483) nidogen 2 (osteonidogen)
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1597 Human Nidogen-2 ELISA human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008695 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008695 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008695 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007361 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083781 MISSION® esiRNA esiRNA human NID2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007361 Rosetta Predictions human pricing
NM_001012005 Rosetta Predictions rat pricing
XM_001055323 Rosetta Predictions rat pricing
XM_001055502 Rosetta Predictions rat pricing
XM_573694 Rosetta Predictions rat pricing
NM_008695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127237 predicted 866
2 SASI_Hs02_00343466 predicted 3658
3 SASI_Hs01_00127238 predicted 1662
4 SASI_Hs01_00127239 predicted 1900
5 SASI_Hs01_00127240 predicted 3772
6 SASI_Hs02_00343467 predicted 2975
7 SASI_Hs01_00127242 predicted 2154
8 SASI_Hs02_00343468 predicted 3706
9 SASI_Hs01_00127243 predicted 2423
10 SASI_Hs02_00343469 predicted 1859
11 SASI_Hs01_00127235 predicted 3981
12 SASI_Hs01_00127236 predicted 1172
13 SASI_Hs01_00127241 predicted 4030
14 SASI_Hs01_00127244 predicted 2144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012005 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00200071 predicted 3252
2 SASI_Rn02_00200072 predicted 4088
3 SASI_Rn02_00200073 predicted 2979
4 SASI_Rn02_00200074 predicted 351
5 SASI_Rn02_00200075 predicted 3823
6 SASI_Rn02_00200076 predicted 3775
7 SASI_Rn02_00200077 predicted 1733
8 SASI_Rn02_00200078 predicted 2051
9 SASI_Rn02_00200079 predicted 3614
10 SASI_Rn02_00200080 predicted 1481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279197 predicted 3325
2 SASI_Rn02_00279198 predicted 4156
3 SASI_Rn02_00279199 predicted 3054
4 SASI_Rn02_00279200 predicted 422
5 SASI_Rn02_00279201 predicted 3889
6 SASI_Rn02_00279202 predicted 3848
7 SASI_Rn02_00279203 predicted 1802
8 SASI_Rn02_00279204 predicted 2122
9 SASI_Rn02_00279205 predicted 3688
10 SASI_Rn02_00279206 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055502 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279741 predicted 3321
2 SASI_Rn02_00279742 predicted 4165
3 SASI_Rn02_00279743 predicted 3046
4 SASI_Rn02_00279744 predicted 423
5 SASI_Rn02_00279745 predicted 3895
6 SASI_Rn02_00279746 predicted 3852
7 SASI_Rn02_00279747 predicted 1800
8 SASI_Rn02_00279748 predicted 2120
9 SASI_Rn02_00279749 predicted 3687
10 SASI_Rn02_00279750 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400642 predicted 4392
2 SASI_Rn02_00400643 predicted 4306
3 SASI_Rn02_00400644 predicted 4147
4 SASI_Rn02_00400645 predicted 4423
5 SASI_Rn02_00400646 predicted 4457
6 SASI_Rn02_00400647 predicted 4265
7 SASI_Rn02_00400648 predicted 4285
8 SASI_Rn02_00400649 predicted 4183
9 SASI_Rn02_00400650 predicted 4401
10 SASI_Rn02_00400651 predicted 4346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078592 predicted 2131
2 SASI_Mm01_00078593 predicted 2224
3 SASI_Mm01_00078594 predicted 3328
4 SASI_Mm01_00078595 predicted 1555
5 SASI_Mm01_00078596 predicted 3765
6 SASI_Mm01_00078597 predicted 3286
7 SASI_Mm01_00078598 predicted 1567
8 SASI_Mm01_00078599 predicted 3907
9 SASI_Mm01_00078600 predicted 1808
10 SASI_Mm02_00314509 predicted 808
11 SASI_Mm01_00078601 predicted 2950
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008695
VALIDATED
NID2 MISSION shRNA Bacterial Glycerol Stock
nidogen 2 (osteonidogen)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2120s21c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-4128s21c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2195s21c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008695.2-4458s21c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-4484s1c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-4090s1c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2157s1c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2082s1c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-790s1c1
Sequence:CCGGGCAGTTTGTGAAGAATCTTTACTCGAGTAAAGATTCTTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008695
VALIDATED
NID2 MISSION shRNA shRNA Plasmid DNA
nidogen 2 (osteonidogen)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2120s21c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-4128s21c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2195s21c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008695.2-4458s21c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-4484s1c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-4090s1c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2157s1c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2082s1c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-790s1c1
Sequence:CCGGGCAGTTTGTGAAGAATCTTTACTCGAGTAAAGATTCTTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008695
VALIDATED
NID2 MISSION shRNA Lentiviral Transduction Particles
nidogen 2 (osteonidogen)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2120s21c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-4128s21c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008695.2-2195s21c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336463    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008695.2-4458s21c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-4484s1c1
Sequence:CCGGCCTCAATCTTTACTACTGTATCTCGAGATACAGTAGTAAAGATTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-4090s1c1
Sequence:CCGGCGTCAGCTATGCAGATCACTTCTCGAGAAGTGATCTGCATAGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2157s1c1
Sequence:CCGGCCCGAAGTTTCTCTCTCACTTCTCGAGAAGTGAGAGAGAAACTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008695.1-2082s1c1
Sequence:CCGGCGAATTTCACAGCCCACATTACTCGAGTAATGTGGGCTGTGAAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008695.1-790s1c1
Sequence:CCGGGCAGTTTGTGAAGAATCTTTACTCGAGTAAAGATTCTTCACAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007361
VALIDATED
NID2 MISSION shRNA Bacterial Glycerol Stock
nidogen 2 (osteonidogen)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-4186s21c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-2415s21c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-928s21c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-509s21c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-2748s1c1
Sequence:CCGGCCGGCATACTTGCATCTTGATCTCGAGATCAAGATGCAAGTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-4186s1c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-928s1c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007361.2-2415s1c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-509s1c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007361
VALIDATED
NID2 MISSION shRNA shRNA Plasmid DNA
nidogen 2 (osteonidogen)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-4186s21c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-2415s21c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-928s21c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-509s21c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-2748s1c1
Sequence:CCGGCCGGCATACTTGCATCTTGATCTCGAGATCAAGATGCAAGTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-4186s1c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-928s1c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007361.2-2415s1c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-509s1c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007361
VALIDATED
NID2 MISSION shRNA Lentiviral Transduction Particles
nidogen 2 (osteonidogen)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-4186s21c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-2415s21c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-928s21c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007361.3-509s21c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-2748s1c1
Sequence:CCGGCCGGCATACTTGCATCTTGATCTCGAGATCAAGATGCAAGTATGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-4186s1c1
Sequence:CCGGCCCTTCAGCATCGTAAGCTATCTCGAGATAGCTTACGATGCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-928s1c1
Sequence:CCGGGCTGATGATCTGAAGTCAGAACTCGAGTTCTGACTTCAGATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007361.2-2415s1c1
Sequence:CCGGCCGGGTCTTTGCCTTGTATAACTCGAGTTATACAAGGCAAAGACCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007361.2-509s1c1
Sequence:CCGGCGCAGTATGTGGACTATGATTCTCGAGAATCATAGTCCACATACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks