EMAIL THIS PAGE TO A FRIEND

NIN

ninein (GSK3B interacting protein)

Synonyms: SCKL7
Gene ID:
Human(51199) Summary: This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(18080) ninein
Rat(299117) ninein (GSK3B interacting protein)
Zebrafish(571879) ninein (GSK3B interacting protein)
chicken(428928) ninein (GSK3B interacting protein)
domestic cat(101096399) ninein (GSK3B interacting protein)
cow(510366) ninein (GSK3B interacting protein)
Horse(100066583) ninein (GSK3B interacting protein)
dog(480320) ninein (GSK3B interacting protein)
domestic guinea pig(100728534) ninein (GSK3B interacting protein)
Domestic Rabbit(100351189) ninein (GSK3B interacting protein)
naked mole-rat(101725944) ninein (GSK3B interacting protein)
sheep(101104912) ninein (GSK3B interacting protein)
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016350 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016350 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016350 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091481 MISSION® esiRNA esiRNA human NIN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016350 Rosetta Predictions human pricing
NM_020921 Rosetta Predictions human pricing
NM_182944 Rosetta Predictions human pricing
NM_182945 Rosetta Predictions human pricing
NM_182946 Rosetta Predictions human pricing
NM_001106737 Rosetta Predictions rat pricing
NM_001081453 Rosetta Predictions mouse pricing
NM_008697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016350 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028467 predicted 2323
2 SASI_Hs01_00028470 predicted 3970
3 SASI_Hs01_00028471 predicted 1329
4 SASI_Hs02_00349309 predicted 1979
5 SASI_Hs01_00028472 predicted 1456
6 SASI_Hs01_00028473 predicted 5463
7 SASI_Hs01_00028474 predicted 3258
8 SASI_Hs01_00028476 predicted 1107
9 SASI_Hs02_00349310 predicted 3638
10 SASI_Hs02_00349311 predicted 2684
11 SASI_Hs01_00028468 predicted 4103
12 SASI_Hs01_00028469 predicted 3870
13 SASI_Hs01_00028475 predicted 2773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020921 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060920 predicted 2165
2 SASI_Hs01_00060923 predicted 3808
3 SASI_Hs01_00060924 predicted 1175
4 SASI_Hs02_00354290 predicted 1817
5 SASI_Hs01_00060925 predicted 1291
6 SASI_Hs01_00060926 predicted 5298
7 SASI_Hs01_00060927 predicted 3097
8 SASI_Hs01_00060929 predicted 942
9 SASI_Hs02_00354291 predicted 3481
10 SASI_Hs02_00354292 predicted 2520
11 SASI_Hs01_00060921 predicted 3891
12 SASI_Hs01_00060922 predicted 3657
13 SASI_Hs01_00060928 predicted 2555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196521 predicted 2162
2 SASI_Hs01_00196524 predicted 3813
3 SASI_Hs01_00196525 predicted 1168
4 SASI_Hs02_00371077 predicted 1822
5 SASI_Hs01_00196526 predicted 1293
6 SASI_Hs01_00196527 predicted 5298
7 SASI_Hs01_00196528 predicted 3094
8 SASI_Hs01_00196530 predicted 947
9 SASI_Hs02_00371078 predicted 3473
10 SASI_Hs02_00371079 predicted 2525
11 SASI_Hs01_00196522 predicted 3895
12 SASI_Hs01_00196523 predicted 3663
13 SASI_Hs01_00196529 predicted 2564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124726 predicted 2113
2 SASI_Hs01_00124727 predicted 3896
3 SASI_Hs01_00124728 predicted 3655
4 SASI_Hs01_00124729 predicted 3769
5 SASI_Hs01_00124730 predicted 1181
6 SASI_Hs01_00124731 predicted 1301
7 SASI_Hs01_00124732 predicted 5254
8 SASI_Hs01_00124733 predicted 3055
9 SASI_Hs01_00124734 predicted 2562
10 SASI_Hs01_00124735 predicted 951
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166888 predicted 2159
2 SASI_Hs01_00166891 predicted 3813
3 SASI_Hs01_00166892 predicted 1170
4 SASI_Hs02_00371080 predicted 1817
5 SASI_Hs01_00166893 predicted 1299
6 SASI_Hs01_00166894 predicted 5303
7 SASI_Hs01_00166895 predicted 3093
8 SASI_Hs01_00166897 predicted 938
9 SASI_Hs02_00371081 predicted 3473
10 SASI_Hs02_00371082 predicted 2525
11 SASI_Hs01_00166889 predicted 3949
12 SASI_Hs01_00166890 predicted 3714
13 SASI_Hs01_00166896 predicted 2614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106737 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221898 predicted 367
2 SASI_Rn02_00221899 predicted 380
3 SASI_Rn02_00221900 predicted 462
4 SASI_Rn02_00221901 predicted 3889
5 SASI_Rn02_00221902 predicted 4379
6 SASI_Rn02_00221903 predicted 2541
7 SASI_Rn02_00221904 predicted 2590
8 SASI_Rn02_00221905 predicted 3901
9 SASI_Rn02_00221906 predicted 2645
10 SASI_Rn02_00221907 predicted 4502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081453 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298416 predicted 2700
2 SASI_Mm02_00298417 predicted 220
3 SASI_Mm02_00298418 predicted 4682
4 SASI_Mm02_00298419 predicted 1911
5 SASI_Mm02_00298420 predicted 4209
6 SASI_Mm02_00298421 predicted 4613
7 SASI_Mm02_00298422 predicted 3364
8 SASI_Mm02_00298423 predicted 3257
9 SASI_Mm02_00298424 predicted 3826
10 SASI_Mm02_00298425 predicted 4229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180489 predicted 2821
2 SASI_Mm01_00180491 predicted 345
3 SASI_Mm01_00180492 predicted 4802
4 SASI_Mm02_00314512 predicted 2024
5 SASI_Mm01_00180494 predicted 4330
6 SASI_Mm01_00180495 predicted 4731
7 SASI_Mm01_00180496 predicted 3488
8 SASI_Mm02_00314513 predicted 3374
9 SASI_Mm02_00314514 predicted 3945
10 SASI_Mm02_00314515 predicted 4347
11 SASI_Mm01_00180487 predicted 6457
12 SASI_Mm01_00180488 predicted 6404
13 SASI_Mm01_00180490 predicted 5101
14 SASI_Mm01_00180493 predicted 5067
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008697
VALIDATED
NIN MISSION shRNA Bacterial Glycerol Stock
ninein (GSK3B interacting protein)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1274s1c1
Sequence:CCGGCGGCACTTGTTAGAACGAGTTCTCGAGAACTCGTTCTAACAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-5927s1c1
Sequence:CCGGCGAGGATTAGAAACAATCCATCTCGAGATGGATTGTTTCTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-964s1c1
Sequence:CCGGGCATCTCTCTATGCAGTCTTTCTCGAGAAAGACTGCATAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1763s1c1
Sequence:CCGGGCGCAGATGAGAAATGAATATCTCGAGATATTCATTTCTCATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008697.1-5335s1c1
Sequence:CCGGGCACAGAATTGCTACAATGAACTCGAGTTCATTGTAGCAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-435s21c1
Sequence:CCGGGTTAGAGGTGGGAAGCGTTATCTCGAGATAACGCTTCCCACCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-768s21c1
Sequence:CCGGATCTGCGAACAGTATGGATTACTCGAGTAATCCATACTGTTCGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008697
VALIDATED
NIN MISSION shRNA shRNA Plasmid DNA
ninein (GSK3B interacting protein)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1274s1c1
Sequence:CCGGCGGCACTTGTTAGAACGAGTTCTCGAGAACTCGTTCTAACAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-5927s1c1
Sequence:CCGGCGAGGATTAGAAACAATCCATCTCGAGATGGATTGTTTCTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-964s1c1
Sequence:CCGGGCATCTCTCTATGCAGTCTTTCTCGAGAAAGACTGCATAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1763s1c1
Sequence:CCGGGCGCAGATGAGAAATGAATATCTCGAGATATTCATTTCTCATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008697.1-5335s1c1
Sequence:CCGGGCACAGAATTGCTACAATGAACTCGAGTTCATTGTAGCAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-435s21c1
Sequence:CCGGGTTAGAGGTGGGAAGCGTTATCTCGAGATAACGCTTCCCACCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-768s21c1
Sequence:CCGGATCTGCGAACAGTATGGATTACTCGAGTAATCCATACTGTTCGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008697
VALIDATED
NIN MISSION shRNA Lentiviral Transduction Particles
ninein (GSK3B interacting protein)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1274s1c1
Sequence:CCGGCGGCACTTGTTAGAACGAGTTCTCGAGAACTCGTTCTAACAAGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-5927s1c1
Sequence:CCGGCGAGGATTAGAAACAATCCATCTCGAGATGGATTGTTTCTAATCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-964s1c1
Sequence:CCGGGCATCTCTCTATGCAGTCTTTCTCGAGAAAGACTGCATAGAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008697.1-1763s1c1
Sequence:CCGGGCGCAGATGAGAAATGAATATCTCGAGATATTCATTTCTCATCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008697.1-5335s1c1
Sequence:CCGGGCACAGAATTGCTACAATGAACTCGAGTTCATTGTAGCAATTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-435s21c1
Sequence:CCGGGTTAGAGGTGGGAAGCGTTATCTCGAGATAACGCTTCCCACCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008697.2-768s21c1
Sequence:CCGGATCTGCGAACAGTATGGATTACTCGAGTAATCCATACTGTTCGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016350
VALIDATED
NIN MISSION shRNA Bacterial Glycerol Stock
ninein (GSK3B interacting protein)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-4088s1c1
Sequence:CCGGCCCAAATATAAGCTGTTGTATCTCGAGATACAACAGCTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-6144s1c1
Sequence:CCGGCCCTTGAACAAGAATTAGAAACTCGAGTTTCTAATTCTTGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-5677s1c1
Sequence:CCGGGCAGAATGTAAACCTGCAAATCTCGAGATTTGCAGGTTTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-4580s1c1
Sequence:CCGGGCCTGGTTACATGGAACAATTCTCGAGAATTGTTCCATGTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-1460s1c1
Sequence:CCGGCGGCATTTGTTGGAACGAGTTCTCGAGAACTCGTTCCAACAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-4622s21c1
Sequence:CCGGAGAGTACAGAATCAAGTTATACTCGAGTATAACTTGATTCTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-3643s21c1
Sequence:CCGGGTTAGAGCCAGGGTTAGTAATCTCGAGATTACTAACCCTGGCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-5605s21c1
Sequence:CCGGACATCAGAGTGCGAGCTTAAACTCGAGTTTAAGCTCGCACTCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-1348s21c1
Sequence:CCGGCCTCGATGGAAACATCAATTTCTCGAGAAATTGATGTTTCCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016350
VALIDATED
NIN MISSION shRNA shRNA Plasmid DNA
ninein (GSK3B interacting protein)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-4088s1c1
Sequence:CCGGCCCAAATATAAGCTGTTGTATCTCGAGATACAACAGCTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-6144s1c1
Sequence:CCGGCCCTTGAACAAGAATTAGAAACTCGAGTTTCTAATTCTTGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-5677s1c1
Sequence:CCGGGCAGAATGTAAACCTGCAAATCTCGAGATTTGCAGGTTTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-4580s1c1
Sequence:CCGGGCCTGGTTACATGGAACAATTCTCGAGAATTGTTCCATGTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-1460s1c1
Sequence:CCGGCGGCATTTGTTGGAACGAGTTCTCGAGAACTCGTTCCAACAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-4622s21c1
Sequence:CCGGAGAGTACAGAATCAAGTTATACTCGAGTATAACTTGATTCTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-3643s21c1
Sequence:CCGGGTTAGAGCCAGGGTTAGTAATCTCGAGATTACTAACCCTGGCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-5605s21c1
Sequence:CCGGACATCAGAGTGCGAGCTTAAACTCGAGTTTAAGCTCGCACTCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-1348s21c1
Sequence:CCGGCCTCGATGGAAACATCAATTTCTCGAGAAATTGATGTTTCCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016350
VALIDATED
NIN MISSION shRNA Lentiviral Transduction Particles
ninein (GSK3B interacting protein)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-4088s1c1
Sequence:CCGGCCCAAATATAAGCTGTTGTATCTCGAGATACAACAGCTTATATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-6144s1c1
Sequence:CCGGCCCTTGAACAAGAATTAGAAACTCGAGTTTCTAATTCTTGTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016350.3-5677s1c1
Sequence:CCGGGCAGAATGTAAACCTGCAAATCTCGAGATTTGCAGGTTTACATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-4580s1c1
Sequence:CCGGGCCTGGTTACATGGAACAATTCTCGAGAATTGTTCCATGTAACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016350.3-1460s1c1
Sequence:CCGGCGGCATTTGTTGGAACGAGTTCTCGAGAACTCGTTCCAACAAATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-4622s21c1
Sequence:CCGGAGAGTACAGAATCAAGTTATACTCGAGTATAACTTGATTCTGTACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-3643s21c1
Sequence:CCGGGTTAGAGCCAGGGTTAGTAATCTCGAGATTACTAACCCTGGCTCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-5605s21c1
Sequence:CCGGACATCAGAGTGCGAGCTTAAACTCGAGTTTAAGCTCGCACTCTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016350.3-1348s21c1
Sequence:CCGGCCTCGATGGAAACATCAATTTCTCGAGAAATTGATGTTTCCATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks