EMAIL THIS PAGE TO A FRIEND

NIPBL

Nipped-B homolog (Drosophila)

Synonyms: CDLS CDLS1 IDN3 IDN3-B Scc2
Gene ID:
Human(25836) Summary: This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(71175) Nipped-B homolog (Drosophila)
Rat(294787) Nipped-B homolog (Drosophila)
cow(539566) Nipped-B homolog (Drosophila)
Horse(100053547) Nipped-B homolog (Drosophila)
domestic cat(101098358) Nipped-B homolog (Drosophila)
dog(489226) Nipped-B homolog (Drosophila)
sheep(101108516) Nipped-B homolog (Drosophila)
naked mole-rat(101702533) Nipped-B homolog (Drosophila)
domestic guinea pig(100718118) Nipped-B homolog (Drosophila)
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015384 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201232 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201232 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201232 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015384 Rosetta Predictions human pricing
NM_133433 Rosetta Predictions human pricing
NM_001106415 Rosetta Predictions rat pricing
NM_027707 Rosetta Predictions mouse pricing
NM_201232 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040359 predicted 5242
2 SASI_Hs02_00347736 predicted 6402
3 SASI_Hs01_00040360 predicted 4721
4 SASI_Hs01_00040361 predicted 5951
5 SASI_Hs01_00040363 predicted 5846
6 SASI_Hs01_00040364 predicted 1105
7 SASI_Hs01_00040365 predicted 3489
8 SASI_Hs01_00040366 predicted 4917
9 SASI_Hs02_00347737 predicted 4327
10 SASI_Hs02_00347738 predicted 3209
11 SASI_Hs01_00040362 predicted 4671
12 SASI_Hs01_00040367 predicted 1834
13 SASI_Hs01_00040368 predicted 7651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143470 predicted 5246
2 SASI_Hs02_00363106 predicted 6406
3 SASI_Hs01_00143471 predicted 4722
4 SASI_Hs01_00143472 predicted 5951
5 SASI_Hs01_00143474 predicted 5848
6 SASI_Hs01_00143475 predicted 1104
7 SASI_Hs01_00143476 predicted 3487
8 SASI_Hs01_00143477 predicted 4915
9 SASI_Hs02_00363107 predicted 4325
10 SASI_Hs02_00363108 predicted 3206
11 SASI_Hs01_00143473 predicted 4671
12 SASI_Hs01_00143478 predicted 1833
13 SASI_Hs01_00143479 predicted 7652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218738 predicted 2752
2 SASI_Rn02_00218739 predicted 4949
3 SASI_Rn02_00218740 predicted 1586
4 SASI_Rn02_00218741 predicted 3069
5 SASI_Rn02_00218742 predicted 4054
6 SASI_Rn02_00218743 predicted 3145
7 SASI_Rn02_00218744 predicted 4302
8 SASI_Rn02_00218745 predicted 3169
9 SASI_Rn02_00218746 predicted 1402
10 SASI_Rn02_00218747 predicted 1643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088985 predicted 5282
2 SASI_Mm01_00088986 predicted 3385
3 SASI_Mm01_00088987 predicted 5141
4 SASI_Mm01_00088988 predicted 6393
5 SASI_Mm01_00088989 predicted 6619
6 SASI_Mm01_00088990 predicted 682
7 SASI_Mm01_00088991 predicted 5853
8 SASI_Mm02_00332609 predicted 4843
9 SASI_Mm02_00332610 predicted 1865
10 SASI_Mm01_00088992 predicted 1628
11 SASI_Mm01_00088993 predicted 5749
12 SASI_Mm01_00088994 predicted 5899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201232 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351484 predicted 5279
2 SASI_Mm02_00351485 predicted 3386
3 SASI_Mm02_00351486 predicted 5136
4 SASI_Mm02_00351487 predicted 6388
5 SASI_Mm02_00351488 predicted 6625
6 SASI_Mm02_00351489 predicted 684
7 SASI_Mm02_00351490 predicted 5849
8 SASI_Mm02_00351491 predicted 4845
9 SASI_Mm02_00351492 predicted 1868
10 SASI_Mm02_00351493 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015384
VALIDATED
NIPBL MISSION shRNA Bacterial Glycerol Stock
Nipped-B homolog (Drosophila)
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-1876s21c1
Sequence:CCGGATCACAACAGGGACCTATATACTCGAGTATATAGGTCCCTGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8569s21c1
Sequence:CCGGACGTATTTCGCAGCGTATTACCTCGAGGTAATACGCTGCGAAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-3466s21c1
Sequence:CCGGAGGATTAGTTGAAGATCTAAACTCGAGTTTAGATCTTCAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-4381s21c1
Sequence:CCGGGTTATGGAGAGACCTTATTATCTCGAGATAATAAGGTCTCTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-6700s21c1
Sequence:CCGGCACTATTGAGGAAGATCTAATCTCGAGATTAGATCTTCCTCAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8037s21c1
Sequence:CCGGCAGATTCAGAAGACGATATAACTCGAGTTATATCGTCTTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015384.2-5912s1c1
Sequence:CCGGCGCTTTGTGTTCACACCTTTACTCGAGTAAAGGTGTGAACACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6738s1c1
Sequence:CCGGGCAGAGACAGAAGATGATGAACTCGAGTTCATCATCTTCTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1422s1c1
Sequence:CCGGCCTCGTGTTAAACAAGGAGATCTCGAGATCTCCTTGTTTAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-4840s1c1
Sequence:CCGGCCACTAAATGTAGTACGCAAACTCGAGTTTGCGTACTACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1548s1c1
Sequence:CCGGCCTGACAATAAGGCAGAATTTCTCGAGAAATTCTGCCTTATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6633s1c1
Sequence:CCGGCCTGATGAAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015384.2-5461s1c1
Sequence:CCGGCCTACCTACAAGAAGAAGATACTCGAGTATCTTCTTCTTGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-418s1c1
Sequence:CCGGCTCAGGATTCAGACTCCATAACTCGAGTTATGGAGTCTGAATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-2668s1c1
Sequence:CCGGCGGATGCTTGTCTTACAACTACTCGAGTAGTTGTAAGACAAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015384
VALIDATED
NIPBL MISSION shRNA shRNA Plasmid DNA
Nipped-B homolog (Drosophila)
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-1876s21c1
Sequence:CCGGATCACAACAGGGACCTATATACTCGAGTATATAGGTCCCTGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8569s21c1
Sequence:CCGGACGTATTTCGCAGCGTATTACCTCGAGGTAATACGCTGCGAAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-3466s21c1
Sequence:CCGGAGGATTAGTTGAAGATCTAAACTCGAGTTTAGATCTTCAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-4381s21c1
Sequence:CCGGGTTATGGAGAGACCTTATTATCTCGAGATAATAAGGTCTCTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-6700s21c1
Sequence:CCGGCACTATTGAGGAAGATCTAATCTCGAGATTAGATCTTCCTCAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8037s21c1
Sequence:CCGGCAGATTCAGAAGACGATATAACTCGAGTTATATCGTCTTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015384.2-5912s1c1
Sequence:CCGGCGCTTTGTGTTCACACCTTTACTCGAGTAAAGGTGTGAACACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6738s1c1
Sequence:CCGGGCAGAGACAGAAGATGATGAACTCGAGTTCATCATCTTCTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1422s1c1
Sequence:CCGGCCTCGTGTTAAACAAGGAGATCTCGAGATCTCCTTGTTTAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-4840s1c1
Sequence:CCGGCCACTAAATGTAGTACGCAAACTCGAGTTTGCGTACTACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1548s1c1
Sequence:CCGGCCTGACAATAAGGCAGAATTTCTCGAGAAATTCTGCCTTATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6633s1c1
Sequence:CCGGCCTGATGAAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015384.2-5461s1c1
Sequence:CCGGCCTACCTACAAGAAGAAGATACTCGAGTATCTTCTTCTTGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-418s1c1
Sequence:CCGGCTCAGGATTCAGACTCCATAACTCGAGTTATGGAGTCTGAATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-2668s1c1
Sequence:CCGGCGGATGCTTGTCTTACAACTACTCGAGTAGTTGTAAGACAAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015384
VALIDATED
NIPBL MISSION shRNA Lentiviral Transduction Particles
Nipped-B homolog (Drosophila)
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-1876s21c1
Sequence:CCGGATCACAACAGGGACCTATATACTCGAGTATATAGGTCCCTGTTGTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8569s21c1
Sequence:CCGGACGTATTTCGCAGCGTATTACCTCGAGGTAATACGCTGCGAAATACGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-3466s21c1
Sequence:CCGGAGGATTAGTTGAAGATCTAAACTCGAGTTTAGATCTTCAACTAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-4381s21c1
Sequence:CCGGGTTATGGAGAGACCTTATTATCTCGAGATAATAAGGTCTCTCCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-6700s21c1
Sequence:CCGGCACTATTGAGGAAGATCTAATCTCGAGATTAGATCTTCCTCAATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015384.4-8037s21c1
Sequence:CCGGCAGATTCAGAAGACGATATAACTCGAGTTATATCGTCTTCTGAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_015384.2-5912s1c1
Sequence:CCGGCGCTTTGTGTTCACACCTTTACTCGAGTAAAGGTGTGAACACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6738s1c1
Sequence:CCGGGCAGAGACAGAAGATGATGAACTCGAGTTCATCATCTTCTGTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1422s1c1
Sequence:CCGGCCTCGTGTTAAACAAGGAGATCTCGAGATCTCCTTGTTTAACACGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-4840s1c1
Sequence:CCGGCCACTAAATGTAGTACGCAAACTCGAGTTTGCGTACTACATTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015384.2-1548s1c1
Sequence:CCGGCCTGACAATAAGGCAGAATTTCTCGAGAAATTCTGCCTTATTGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015384.2-6633s1c1
Sequence:CCGGCCTGATGAAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015384.2-5461s1c1
Sequence:CCGGCCTACCTACAAGAAGAAGATACTCGAGTATCTTCTTCTTGTAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-418s1c1
Sequence:CCGGCTCAGGATTCAGACTCCATAACTCGAGTTATGGAGTCTGAATCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_015384.2-2668s1c1
Sequence:CCGGCGGATGCTTGTCTTACAACTACTCGAGTAGTTGTAAGACAAGCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201232
VALIDATED
NIPBL MISSION shRNA Bacterial Glycerol Stock
Nipped-B homolog (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-4281s21c1
Sequence:CCGGGATTGTGGAGAGACCTAATTACTCGAGTAATTAGGTCTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-1642s21c1
Sequence:CCGGGGACGTAAACCGCCCACTTAACTCGAGTTAAGTGGGCGGTTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-6722s21c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-535s21c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-5657s21c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-5657s1c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-6722s1c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-535s1c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-1886s1c1
Sequence:CCGGCGCTTCTCAAAGGAAGTTCAACTCGAGTTGAACTTCCTTTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201232.1-7619s1c1
Sequence:CCGGCGCGCCTTTCTTATTTCTTTACTCGAGTAAAGAAATAAGAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201232
VALIDATED
NIPBL MISSION shRNA shRNA Plasmid DNA
Nipped-B homolog (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-4281s21c1
Sequence:CCGGGATTGTGGAGAGACCTAATTACTCGAGTAATTAGGTCTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-1642s21c1
Sequence:CCGGGGACGTAAACCGCCCACTTAACTCGAGTTAAGTGGGCGGTTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-6722s21c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-535s21c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-5657s21c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-5657s1c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-6722s1c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-535s1c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-1886s1c1
Sequence:CCGGCGCTTCTCAAAGGAAGTTCAACTCGAGTTGAACTTCCTTTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201232.1-7619s1c1
Sequence:CCGGCGCGCCTTTCTTATTTCTTTACTCGAGTAAAGAAATAAGAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201232
VALIDATED
NIPBL MISSION shRNA Lentiviral Transduction Particles
Nipped-B homolog (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-4281s21c1
Sequence:CCGGGATTGTGGAGAGACCTAATTACTCGAGTAATTAGGTCTCTCCACAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-1642s21c1
Sequence:CCGGGGACGTAAACCGCCCACTTAACTCGAGTTAAGTGGGCGGTTTACGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-6722s21c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-535s21c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201232.1-5657s21c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-5657s1c1
Sequence:CCGGGCGTGCTTGATTGTTCGATATCTCGAGATATCGAACAATCAAGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-6722s1c1
Sequence:CCGGGCCTGTTTCAATAGATACTATCTCGAGATAGTATCTATTGAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-535s1c1
Sequence:CCGGCCTCCTCTTTAATTCACGAATCTCGAGATTCGTGAATTAAAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_201232.1-1886s1c1
Sequence:CCGGCGCTTCTCAAAGGAAGTTCAACTCGAGTTGAACTTCCTTTGAGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201232.1-7619s1c1
Sequence:CCGGCGCGCCTTTCTTATTTCTTTACTCGAGTAAAGAAATAAGAAAGGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks