EMAIL THIS PAGE TO A FRIEND

NKAIN4

Na+/K+ transporting ATPase interacting 4

Synonyms: C20orf58 FAM77A bA261N11.2
UniProtKB ID: Q8IVV8, Q4VXQ6, Q9BQU8, Q9BQU9
Gene ID:
Human(128414) Summary: NKAIN4 is a member of a family of mammalian proteins (see NKAIN1; MIM 612871) with similarity to Drosophila Nkain and interacts with the beta subunit of Na,K-ATPase (ATP1B1; MIM 182330) (Gorokhova et al., 2007 [PubMed 17606467]
Mouse(58237) Na+/K+ transporting ATPase interacting 4
Rat(296469) Na+/K+ transporting ATPase interacting 4
Zebrafish(100002876) Na+/K+ transporting ATPase interacting 4
cow(100138395) Na+/K+ transporting ATPase interacting 4
dog(485970) Na+/K+ transporting ATPase interacting 4
chicken(419240) Na+/K+ transporting ATPase interacting 4
naked mole-rat(101710151) Na+/K+ transporting ATPase interacting 4
domestic guinea pig(100717429) Na+/K+ transporting ATPase interacting 4
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152864 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152864 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152864 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152864 Rosetta Predictions human pricing
NM_001106550 Rosetta Predictions rat pricing
NM_021426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068037 predicted 693
2 SASI_Hs01_00068038 predicted 699
3 SASI_Hs01_00068039 predicted 672
4 SASI_Hs01_00068040 predicted 584
5 SASI_Hs01_00068041 predicted 594
6 SASI_Hs01_00068042 predicted 634
7 SASI_Hs01_00068043 predicted 557
8 SASI_Hs01_00068044 predicted 1189
9 SASI_Hs01_00068045 predicted 348
10 SASI_Hs01_00068046 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106550 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220058 predicted 262
2 SASI_Rn02_00220059 predicted 429
3 SASI_Rn02_00220060 predicted 319
4 SASI_Rn02_00220061 predicted 314
5 SASI_Rn02_00220062 predicted 433
6 SASI_Rn02_00220063 predicted 347
7 SASI_Rn02_00220064 predicted 241
8 SASI_Rn02_00220065 predicted 226
9 SASI_Rn02_00220066 predicted 343
10 SASI_Rn02_00220067 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025252 predicted 359
2 SASI_Mm01_00025253 predicted 480
3 SASI_Mm01_00025254 predicted 269
4 SASI_Mm01_00025255 predicted 276
5 SASI_Mm01_00025256 predicted 214
6 SASI_Mm01_00025257 predicted 246
7 SASI_Mm02_00326062 predicted 218
8 SASI_Mm01_00025258 predicted 258
9 SASI_Mm01_00025259 predicted 658
10 SASI_Mm01_00025260 predicted 269
11 SASI_Mm01_00025261 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152864
NKAIN4 MISSION shRNA Bacterial Glycerol Stock
Na+/K+ transporting ATPase interacting 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-699s21c1
Sequence:CCGGGGTGTACTTGCCTGCGTAAGTCTCGAGACTTACGCAGGCAAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-905s21c1
Sequence:CCGGAGCGTCAAGAGAGTTTGTAATCTCGAGATTACAAACTCTCTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-1176s21c1
Sequence:CCGGTTGAACATGGAGGGTTCCTAACTCGAGTTAGGAACCCTCCATGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-343s21c1
Sequence:CCGGGAAGTCGGTGGCCTCTTAAAGCTCGAGCTTTAAGAGGCCACCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-267s21c1
Sequence:CCGGGCGCTATGTCATGGTGTACACCTCGAGGTGTACACCATGACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-590s1c1
Sequence:CCGGGTCAGCGTGTTTACGGATGAACTCGAGTTCATCCGTAAACACGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-313s1c1
Sequence:CCGGGAACGTCTTCATCATCTGCTTCTCGAGAAGCAGATGATGAAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-611s1c1
Sequence:CCGGGAGGACAGCTTTGATTTCATTCTCGAGAATGAAATCAAAGCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-618s1c1
Sequence:CCGGGCTTTGATTTCATTGGTGGATCTCGAGATCCACCAATGAAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152864.2-605s1c1
Sequence:CCGGGATGAAGAGGACAGCTTTGATCTCGAGATCAAAGCTGTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-650s1c1
Sequence:CCGGCCTCTCTACCATGTCAATGAACTCGAGTTCATTGACATGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152864
NKAIN4 MISSION shRNA shRNA Plasmid DNA
Na+/K+ transporting ATPase interacting 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-699s21c1
Sequence:CCGGGGTGTACTTGCCTGCGTAAGTCTCGAGACTTACGCAGGCAAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-905s21c1
Sequence:CCGGAGCGTCAAGAGAGTTTGTAATCTCGAGATTACAAACTCTCTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-1176s21c1
Sequence:CCGGTTGAACATGGAGGGTTCCTAACTCGAGTTAGGAACCCTCCATGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-343s21c1
Sequence:CCGGGAAGTCGGTGGCCTCTTAAAGCTCGAGCTTTAAGAGGCCACCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-267s21c1
Sequence:CCGGGCGCTATGTCATGGTGTACACCTCGAGGTGTACACCATGACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-590s1c1
Sequence:CCGGGTCAGCGTGTTTACGGATGAACTCGAGTTCATCCGTAAACACGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-313s1c1
Sequence:CCGGGAACGTCTTCATCATCTGCTTCTCGAGAAGCAGATGATGAAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-611s1c1
Sequence:CCGGGAGGACAGCTTTGATTTCATTCTCGAGAATGAAATCAAAGCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-618s1c1
Sequence:CCGGGCTTTGATTTCATTGGTGGATCTCGAGATCCACCAATGAAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152864.2-605s1c1
Sequence:CCGGGATGAAGAGGACAGCTTTGATCTCGAGATCAAAGCTGTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-650s1c1
Sequence:CCGGCCTCTCTACCATGTCAATGAACTCGAGTTCATTGACATGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152864
NKAIN4 MISSION shRNA Lentiviral Transduction Particles
Na+/K+ transporting ATPase interacting 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-699s21c1
Sequence:CCGGGGTGTACTTGCCTGCGTAAGTCTCGAGACTTACGCAGGCAAGTACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-905s21c1
Sequence:CCGGAGCGTCAAGAGAGTTTGTAATCTCGAGATTACAAACTCTCTTGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436258    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152864.3-1176s21c1
Sequence:CCGGTTGAACATGGAGGGTTCCTAACTCGAGTTAGGAACCCTCCATGTTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-343s21c1
Sequence:CCGGGAAGTCGGTGGCCTCTTAAAGCTCGAGCTTTAAGAGGCCACCGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152864.3-267s21c1
Sequence:CCGGGCGCTATGTCATGGTGTACACCTCGAGGTGTACACCATGACATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-590s1c1
Sequence:CCGGGTCAGCGTGTTTACGGATGAACTCGAGTTCATCCGTAAACACGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-313s1c1
Sequence:CCGGGAACGTCTTCATCATCTGCTTCTCGAGAAGCAGATGATGAAGACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-611s1c1
Sequence:CCGGGAGGACAGCTTTGATTTCATTCTCGAGAATGAAATCAAAGCTGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-618s1c1
Sequence:CCGGGCTTTGATTTCATTGGTGGATCTCGAGATCCACCAATGAAATCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152864.2-605s1c1
Sequence:CCGGGATGAAGAGGACAGCTTTGATCTCGAGATCAAAGCTGTCCTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152864.2-650s1c1
Sequence:CCGGCCTCTCTACCATGTCAATGAACTCGAGTTCATTGACATGGTAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021426
NKAIN4 MISSION shRNA Bacterial Glycerol Stock
Na+/K+ transporting ATPase interacting 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-251s21c1
Sequence:CCGGCACGCTACATCGTGGTGTATGCTCGAGCATACACCACGATGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-225s21c1
Sequence:CCGGGCTCTTCGGCACCATTCAATACTCGAGTATTGAATGGTGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-137s21c1
Sequence:CCGGCTCTGGAACGGCAAGTCTTTGCTCGAGCAAAGACTTGCCGTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-672s21c1
Sequence:CCGGCTTGTCCAAGCAGGCATATTTCTCGAGAAATATGCCTGCTTGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021426.4-736s21c1
Sequence:CCGGAGCCTCAGCCACGGAAACAATCTCGAGATTGTTTCCGTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-295s1c1
Sequence:CCGGGAATGTCTTCATTATCTGCTTCTCGAGAAGCAGATAATGAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-196s1c1
Sequence:CCGGCCACATCATCGTGGTCATCTTCTCGAGAAGATGACCACGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-633s1c1
Sequence:CCGGCCCTGTACCATGTCAATGAAACTCGAGTTTCATTGACATGGTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021426
NKAIN4 MISSION shRNA shRNA Plasmid DNA
Na+/K+ transporting ATPase interacting 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-251s21c1
Sequence:CCGGCACGCTACATCGTGGTGTATGCTCGAGCATACACCACGATGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-225s21c1
Sequence:CCGGGCTCTTCGGCACCATTCAATACTCGAGTATTGAATGGTGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-137s21c1
Sequence:CCGGCTCTGGAACGGCAAGTCTTTGCTCGAGCAAAGACTTGCCGTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-672s21c1
Sequence:CCGGCTTGTCCAAGCAGGCATATTTCTCGAGAAATATGCCTGCTTGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021426.4-736s21c1
Sequence:CCGGAGCCTCAGCCACGGAAACAATCTCGAGATTGTTTCCGTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-295s1c1
Sequence:CCGGGAATGTCTTCATTATCTGCTTCTCGAGAAGCAGATAATGAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-196s1c1
Sequence:CCGGCCACATCATCGTGGTCATCTTCTCGAGAAGATGACCACGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-633s1c1
Sequence:CCGGCCCTGTACCATGTCAATGAAACTCGAGTTTCATTGACATGGTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021426
NKAIN4 MISSION shRNA Lentiviral Transduction Particles
Na+/K+ transporting ATPase interacting 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246393    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-251s21c1
Sequence:CCGGCACGCTACATCGTGGTGTATGCTCGAGCATACACCACGATGTAGCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-225s21c1
Sequence:CCGGGCTCTTCGGCACCATTCAATACTCGAGTATTGAATGGTGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-137s21c1
Sequence:CCGGCTCTGGAACGGCAAGTCTTTGCTCGAGCAAAGACTTGCCGTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021426.4-672s21c1
Sequence:CCGGCTTGTCCAAGCAGGCATATTTCTCGAGAAATATGCCTGCTTGGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021426.4-736s21c1
Sequence:CCGGAGCCTCAGCCACGGAAACAATCTCGAGATTGTTTCCGTGGCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-295s1c1
Sequence:CCGGGAATGTCTTCATTATCTGCTTCTCGAGAAGCAGATAATGAAGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-196s1c1
Sequence:CCGGCCACATCATCGTGGTCATCTTCTCGAGAAGATGACCACGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021426.3-633s1c1
Sequence:CCGGCCCTGTACCATGTCAATGAAACTCGAGTTTCATTGACATGGTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks