EMAIL THIS PAGE TO A FRIEND

NKAPL

NFKB activating protein-like

Synonyms: C6orf194 bA424I5.1
UniProtKB ID: Q5M9Q1, Q3MIV1, Q9H4Q7
Gene ID:
Mouse(66707) NFKB activating protein-like
Rat(291165) NFKB activating protein-like
cow(515716) NFKB activating protein-like
dog(100682944) NFKB activating protein-like
domestic cat(101088332) NFKB activating protein-like
sheep(101122898) NFKB activating protein-like
naked mole-rat(101697095) NFKB activating protein-like
domestic guinea pig(101787654) NFKB activating protein-like
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001007531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007531 Rosetta Predictions human pricing
NM_001029913 Rosetta Predictions rat pricing
NM_025719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108458 predicted 1115
2 SASI_Hs01_00108459 predicted 1336
3 SASI_Hs01_00108460 predicted 1089
4 SASI_Hs01_00108461 predicted 1102
5 SASI_Hs01_00108462 predicted 1384
6 SASI_Hs01_00108463 predicted 1331
7 SASI_Hs01_00108464 predicted 1247
8 SASI_Hs01_00108465 predicted 333
9 SASI_Hs01_00108467 predicted 271
10 SASI_Hs02_00305321 predicted 1248
11 SASI_Hs01_00108466 predicted 1003
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117912 predicted 1054
2 SASI_Rn01_00117913 predicted 980
3 SASI_Rn01_00117914 predicted 259
4 SASI_Rn01_00117916 predicted 315
5 SASI_Rn01_00117917 predicted 1171
6 SASI_Rn02_00203479 predicted 1206
7 SASI_Rn01_00117918 predicted 1217
8 SASI_Rn01_00117919 predicted 1173
9 SASI_Rn01_00117920 predicted 1030
10 SASI_Rn01_00117921 predicted 1007
11 SASI_Rn01_00117915 predicted 1269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037393 predicted 1064
2 SASI_Mm01_00037394 predicted 1086
3 SASI_Mm01_00037395 predicted 1067
4 SASI_Mm01_00037396 predicted 1084
5 SASI_Mm01_00037397 predicted 1008
6 SASI_Mm01_00037399 predicted 321
7 SASI_Mm01_00037400 predicted 1067
8 SASI_Mm01_00037401 predicted 1013
9 SASI_Mm01_00037402 predicted 1009
10 SASI_Mm02_00328904 predicted 1094
11 SASI_Mm01_00037398 predicted 1011
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007531
NKAPL MISSION shRNA Bacterial Glycerol Stock
NFKB activating protein-like
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-482s1c1
Sequence:CCGGCCTCAGCTAGATTCTGACGAACTCGAGTTCGTCAGAATCTAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007531.1-586s1c1
Sequence:CCGGGAAGACCAGTCGTTCAAGAAACTCGAGTTTCTTGAACGACTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1180s1c1
Sequence:CCGGGAGACGAAAGAGAGAAAGTAACTCGAGTTACTTTCTCTCTTTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1014s1c1
Sequence:CCGGGAGGTGAAATTGGGTTGACAACTCGAGTTGTCAACCCAATTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-557s1c1
Sequence:CCGGGATTCCAACTCGGAAGAACATCTCGAGATGTTCTTCCGAGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-518s1c1
Sequence:CCGGGATGAAGAAGAGGTAACGCATCTCGAGATGCGTTACCTCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007531
NKAPL MISSION shRNA shRNA Plasmid DNA
NFKB activating protein-like
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-482s1c1
Sequence:CCGGCCTCAGCTAGATTCTGACGAACTCGAGTTCGTCAGAATCTAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007531.1-586s1c1
Sequence:CCGGGAAGACCAGTCGTTCAAGAAACTCGAGTTTCTTGAACGACTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1180s1c1
Sequence:CCGGGAGACGAAAGAGAGAAAGTAACTCGAGTTACTTTCTCTCTTTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1014s1c1
Sequence:CCGGGAGGTGAAATTGGGTTGACAACTCGAGTTGTCAACCCAATTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-557s1c1
Sequence:CCGGGATTCCAACTCGGAAGAACATCTCGAGATGTTCTTCCGAGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-518s1c1
Sequence:CCGGGATGAAGAAGAGGTAACGCATCTCGAGATGCGTTACCTCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007531
NKAPL MISSION shRNA Lentiviral Transduction Particles
NFKB activating protein-like
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-482s1c1
Sequence:CCGGCCTCAGCTAGATTCTGACGAACTCGAGTTCGTCAGAATCTAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007531.1-586s1c1
Sequence:CCGGGAAGACCAGTCGTTCAAGAAACTCGAGTTTCTTGAACGACTGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1180s1c1
Sequence:CCGGGAGACGAAAGAGAGAAAGTAACTCGAGTTACTTTCTCTCTTTCGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-1014s1c1
Sequence:CCGGGAGGTGAAATTGGGTTGACAACTCGAGTTGTCAACCCAATTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-557s1c1
Sequence:CCGGGATTCCAACTCGGAAGAACATCTCGAGATGTTCTTCCGAGTTGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007531.1-518s1c1
Sequence:CCGGGATGAAGAAGAGGTAACGCATCTCGAGATGCGTTACCTCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025719
NKAPL MISSION shRNA Bacterial Glycerol Stock
NFKB activating protein-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025719.1-1239s1c1
Sequence:CCGGCCTGTTTGTTTCACTGTGGGACTCGAGTCCCACAGTGAAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-741s1c1
Sequence:CCGGCTCAAGAAGAAGAGGACTAAACTCGAGTTTAGTCCTCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-840s1c1
Sequence:CCGGGCAGAGAGCATGGATTTAATACTCGAGTATTAAATCCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-533s1c1
Sequence:CCGGGAAGAGTAGCAGTTCAGATTTCTCGAGAAATCTGAACTGCTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-886s1c1
Sequence:CCGGCCTCTCAAGATGAGAACACTTCTCGAGAAGTGTTCTCATCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025719
NKAPL MISSION shRNA shRNA Plasmid DNA
NFKB activating protein-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025719.1-1239s1c1
Sequence:CCGGCCTGTTTGTTTCACTGTGGGACTCGAGTCCCACAGTGAAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-741s1c1
Sequence:CCGGCTCAAGAAGAAGAGGACTAAACTCGAGTTTAGTCCTCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-840s1c1
Sequence:CCGGGCAGAGAGCATGGATTTAATACTCGAGTATTAAATCCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-533s1c1
Sequence:CCGGGAAGAGTAGCAGTTCAGATTTCTCGAGAAATCTGAACTGCTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-886s1c1
Sequence:CCGGCCTCTCAAGATGAGAACACTTCTCGAGAAGTGTTCTCATCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025719
NKAPL MISSION shRNA Lentiviral Transduction Particles
NFKB activating protein-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025719.1-1239s1c1
Sequence:CCGGCCTGTTTGTTTCACTGTGGGACTCGAGTCCCACAGTGAAACAAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-741s1c1
Sequence:CCGGCTCAAGAAGAAGAGGACTAAACTCGAGTTTAGTCCTCTTCTTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-840s1c1
Sequence:CCGGGCAGAGAGCATGGATTTAATACTCGAGTATTAAATCCATGCTCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-533s1c1
Sequence:CCGGGAAGAGTAGCAGTTCAGATTTCTCGAGAAATCTGAACTGCTACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025719.1-886s1c1
Sequence:CCGGCCTCTCAAGATGAGAACACTTCTCGAGAAGTGTTCTCATCTTGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks