EMAIL THIS PAGE TO A FRIEND

NKTR

natural killer-tumor recognition sequence

Synonyms: p104
UniProtKB ID: P30414
Gene ID:
Human(4820) Summary: This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Mouse(18087) natural killer tumor recognition sequence
Rat(100364165) natural killer-tumor recognition sequence
sheep(101117198) natural killer-tumor recognition sequence
naked mole-rat(101715614) natural killer-tumor recognition sequence
domestic guinea pig(100733444) natural killer-tumor recognition sequence
Zebrafish(323005) natural killer-tumor recognition sequence
cow(100335533) natural killer-tumor recognition sequence
Horse(100067428) natural killer-tumor recognition sequence
domestic cat(101095608) natural killer-tumor recognition sequence
dog(609597) natural killer-tumor recognition sequence
chicken(420388) natural killer-tumor recognition sequence
86 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005385 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010918 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010918 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010918 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012651 Rosetta Predictions human pricing
NM_005385 Rosetta Predictions human pricing
NM_010918 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070823 predicted 331
2 SASI_Hs01_00070824 predicted 317
3 SASI_Hs01_00070825 predicted 216
4 SASI_Hs01_00070826 predicted 401
5 SASI_Hs01_00070827 predicted 411
6 SASI_Hs01_00070828 predicted 645
7 SASI_Hs01_00070829 predicted 613
8 SASI_Hs01_00070830 predicted 778
9 SASI_Hs01_00070831 predicted 483
10 SASI_Hs01_00070832 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226263 predicted 4258
2 SASI_Hs01_00226264 predicted 1117
3 SASI_Hs01_00226265 predicted 4186
4 SASI_Hs01_00226266 predicted 4135
5 SASI_Hs01_00226267 predicted 4086
6 SASI_Hs01_00226268 predicted 4473
7 SASI_Hs01_00226269 predicted 3529
8 SASI_Hs01_00226270 predicted 1083
9 SASI_Hs02_00339502 predicted 403
10 SASI_Hs01_00226272 predicted 1109
11 SASI_Hs01_00226271 predicted 4586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010918 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136245 predicted 2766
2 SASI_Mm02_00319654 predicted 201
3 SASI_Mm02_00319655 predicted 1720
4 SASI_Mm01_00136247 predicted 2147
5 SASI_Mm01_00136248 predicted 4232
6 SASI_Mm01_00136250 predicted 2534
7 SASI_Mm01_00136252 predicted 4590
8 SASI_Mm01_00136253 predicted 2496
9 SASI_Mm01_00136254 predicted 3570
10 SASI_Mm02_00319656 predicted 3333
11 SASI_Mm01_00136246 predicted 204
12 SASI_Mm01_00136249 predicted 3854
13 SASI_Mm01_00136251 predicted 1150
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005385
VALIDATED
NKTR MISSION shRNA Bacterial Glycerol Stock
natural killer-tumor recognition sequence
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005385.2-1104s1c1
Sequence:CCGGGCAGAACCTGAACCGAAGATTCTCGAGAATCTTCGGTTCAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-4219s1c1
Sequence:CCGGCCACATCATCTTATCGATCAACTCGAGTTGATCGATAAGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-929s1c1
Sequence:CCGGGCCAAGGAATAAACATGCAATCTCGAGATTGCATGTTTATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-2935s1c1
Sequence:CCGGCCGATTCTGAATCAGAGGTTACTCGAGTAACCTCTGATTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005385.3-5168s21c1
Sequence:CCGGTCAATCAGCCTTAACTATAAACTCGAGTTTATAGTTAAGGCTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-560s21c1
Sequence:CCGGTAGTCTTTGGACTGGTTATTTCTCGAGAAATAACCAGTCCAAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005385.3-639s21c1
Sequence:CCGGATATGCAGATGTGCGAGTTATCTCGAGATAACTCGCACATCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-2319s21c1
Sequence:CCGGTAGATCTCATTCACGAAATAACTCGAGTTATTTCGTGAATGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-1363s21c1
Sequence:CCGGTCCAGATCATGGTCCTATAATCTCGAGATTATAGGACCATGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005385
VALIDATED
NKTR MISSION shRNA shRNA Plasmid DNA
natural killer-tumor recognition sequence
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005385.2-1104s1c1
Sequence:CCGGGCAGAACCTGAACCGAAGATTCTCGAGAATCTTCGGTTCAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-4219s1c1
Sequence:CCGGCCACATCATCTTATCGATCAACTCGAGTTGATCGATAAGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-929s1c1
Sequence:CCGGGCCAAGGAATAAACATGCAATCTCGAGATTGCATGTTTATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-2935s1c1
Sequence:CCGGCCGATTCTGAATCAGAGGTTACTCGAGTAACCTCTGATTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005385.3-5168s21c1
Sequence:CCGGTCAATCAGCCTTAACTATAAACTCGAGTTTATAGTTAAGGCTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-560s21c1
Sequence:CCGGTAGTCTTTGGACTGGTTATTTCTCGAGAAATAACCAGTCCAAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005385.3-639s21c1
Sequence:CCGGATATGCAGATGTGCGAGTTATCTCGAGATAACTCGCACATCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-2319s21c1
Sequence:CCGGTAGATCTCATTCACGAAATAACTCGAGTTATTTCGTGAATGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-1363s21c1
Sequence:CCGGTCCAGATCATGGTCCTATAATCTCGAGATTATAGGACCATGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005385
VALIDATED
NKTR MISSION shRNA Lentiviral Transduction Particles
natural killer-tumor recognition sequence
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005385.2-1104s1c1
Sequence:CCGGGCAGAACCTGAACCGAAGATTCTCGAGAATCTTCGGTTCAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-4219s1c1
Sequence:CCGGCCACATCATCTTATCGATCAACTCGAGTTGATCGATAAGATGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-929s1c1
Sequence:CCGGGCCAAGGAATAAACATGCAATCTCGAGATTGCATGTTTATTCCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005385.2-2935s1c1
Sequence:CCGGCCGATTCTGAATCAGAGGTTACTCGAGTAACCTCTGATTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005385.3-5168s21c1
Sequence:CCGGTCAATCAGCCTTAACTATAAACTCGAGTTTATAGTTAAGGCTGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-560s21c1
Sequence:CCGGTAGTCTTTGGACTGGTTATTTCTCGAGAAATAACCAGTCCAAAGACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005385.3-639s21c1
Sequence:CCGGATATGCAGATGTGCGAGTTATCTCGAGATAACTCGCACATCTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-2319s21c1
Sequence:CCGGTAGATCTCATTCACGAAATAACTCGAGTTATTTCGTGAATGAGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005385.3-1363s21c1
Sequence:CCGGTCCAGATCATGGTCCTATAATCTCGAGATTATAGGACCATGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010918
VALIDATED
NKTR MISSION shRNA Bacterial Glycerol Stock
natural killer-tumor recognition sequence
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010918.2-5105s1c1
Sequence:CCGGCCTATGTCATATTGTCACATACTCGAGTATGTGACAATATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-4286s1c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2518s1c1
Sequence:CCGGCGTCACAGAAAGTATAGTGAACTCGAGTTCACTATACTTTCTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010918.2-1872s1c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2355s1c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-1872s21c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-4286s21c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010918.2-2355s21c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010918.2-4602s21c1
Sequence:CCGGTCAATCCTATAGTGGATATTTCTCGAGAAATATCCACTATAGGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-195s21c1
Sequence:CCGGGGAACCGGTTGGTCGAATTATCTCGAGATAATTCGACCAACCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010918
VALIDATED
NKTR MISSION shRNA shRNA Plasmid DNA
natural killer-tumor recognition sequence
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010918.2-5105s1c1
Sequence:CCGGCCTATGTCATATTGTCACATACTCGAGTATGTGACAATATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-4286s1c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2518s1c1
Sequence:CCGGCGTCACAGAAAGTATAGTGAACTCGAGTTCACTATACTTTCTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010918.2-1872s1c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2355s1c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-1872s21c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-4286s21c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010918.2-2355s21c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010918.2-4602s21c1
Sequence:CCGGTCAATCCTATAGTGGATATTTCTCGAGAAATATCCACTATAGGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-195s21c1
Sequence:CCGGGGAACCGGTTGGTCGAATTATCTCGAGATAATTCGACCAACCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010918
VALIDATED
NKTR MISSION shRNA Lentiviral Transduction Particles
natural killer-tumor recognition sequence
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101245    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010918.2-5105s1c1
Sequence:CCGGCCTATGTCATATTGTCACATACTCGAGTATGTGACAATATGACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-4286s1c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2518s1c1
Sequence:CCGGCGTCACAGAAAGTATAGTGAACTCGAGTTCACTATACTTTCTGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010918.2-1872s1c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010918.2-2355s1c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-1872s21c1
Sequence:CCGGGCCAGTTAAGACAGAACCTTTCTCGAGAAAGGTTCTGTCTTAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-4286s21c1
Sequence:CCGGGCAGCTCTTATGACCTCCATACTCGAGTATGGAGGTCATAAGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010918.2-2355s21c1
Sequence:CCGGGCACAGTAGGTCATCTTCATACTCGAGTATGAAGATGACCTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010918.2-4602s21c1
Sequence:CCGGTCAATCCTATAGTGGATATTTCTCGAGAAATATCCACTATAGGATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010918.2-195s21c1
Sequence:CCGGGGAACCGGTTGGTCGAATTATCTCGAGATAATTCGACCAACCGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks