EMAIL THIS PAGE TO A FRIEND

NKX2-6

NK2 homeobox 6

Synonyms: CSX2 NKX2F NKX4-2
UniProtKB ID: A6NCS4
Gene ID:
Human(137814) Summary: This gene encodes a homeobox-containing protein that belongs to the NK-2 homeobox family. This protein is a vertebrate homolog of Drosophila homeobox-containing protein called 'tinman', which has been shown to be essential for development of the heart-like dorsal vessel. In conjunction with related gene, NKX2-5, this gene may play a role in both pharyngeal and cardiac embryonic development. Mutations in this gene are associated with persistent truncus arteriosus.[provided by RefSeq, Aug 2011]
Mouse(18092) NK2 homeobox 6
Rat(364418) NK2 homeobox 6
chicken(396037) NK2 homeobox 6
domestic cat(101084618) NK2 homeobox 6
cow(527892) NK2 homeobox 6
dog(486113) NK2 homeobox 6
naked mole-rat(101702407) NK2 homeobox 6
sheep(101120306) NK2 homeobox 6
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_070619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_070619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_070619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716458 Rosetta Predictions human pricing
XM_070619 Rosetta Predictions human pricing
XM_939389 Rosetta Predictions human pricing
NM_001127653 Rosetta Predictions rat pricing
NM_010920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00410731 predicted 355
2 SASI_Hs02_00410732 predicted 1192
3 SASI_Hs02_00410733 predicted 495
4 SASI_Hs02_00410734 predicted 1171
5 SASI_Hs02_00410735 predicted 659
6 SASI_Hs02_00410736 predicted 1121
7 SASI_Hs02_00410737 predicted 725
8 SASI_Hs02_00410738 predicted 1120
9 SASI_Hs02_00410739 predicted 690
10 SASI_Hs02_00410740 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_070619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00294369 predicted 353
2 SASI_Hs01_00294370 predicted 359
3 SASI_Hs01_00294371 predicted 665
4 SASI_Hs01_00294372 predicted 503
5 SASI_Hs01_00294373 predicted 659
6 SASI_Hs01_00294374 predicted 670
7 SASI_Hs01_00294375 predicted 693
8 SASI_Hs01_00294376 predicted 441
9 SASI_Hs01_00294377 predicted 522
10 SASI_Hs01_00294378 predicted 455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939389 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483587 predicted 357
2 SASI_Hs02_00483588 predicted 1188
3 SASI_Hs02_00483589 predicted 501
4 SASI_Hs02_00483590 predicted 1172
5 SASI_Hs02_00483591 predicted 655
6 SASI_Hs02_00483592 predicted 1123
7 SASI_Hs02_00483593 predicted 723
8 SASI_Hs02_00483594 predicted 1123
9 SASI_Hs02_00483595 predicted 694
10 SASI_Hs02_00483596 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127653 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254770 predicted 498
2 SASI_Rn02_00254771 predicted 238
3 SASI_Rn02_00254772 predicted 798
4 SASI_Rn02_00254773 predicted 711
5 SASI_Rn02_00254774 predicted 521
6 SASI_Rn02_00254775 predicted 529
7 SASI_Rn02_00254776 predicted 445
8 SASI_Rn02_00254777 predicted 545
9 SASI_Rn02_00254778 predicted 645
10 SASI_Rn02_00254779 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059508 predicted 430
2 SASI_Mm01_00059509 predicted 431
3 SASI_Mm01_00059510 predicted 197
4 SASI_Mm01_00059511 predicted 301
5 SASI_Mm01_00059512 predicted 304
6 SASI_Mm01_00059513 predicted 494
7 SASI_Mm01_00059514 predicted 426
8 SASI_Mm01_00059515 predicted 653
9 SASI_Mm01_00059516 predicted 367
10 SASI_Mm01_00059517 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_070619
NKX2-6 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-228s1c1
Sequence:CCGGGCCCTTTAAGAGAACCGTCAACTCGAGTTGACGGTTCTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-1105s1c1
Sequence:CCGGCGACGCTACAAATGCAAGAGACTCGAGTCTCTTGCATTTGTAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-37s1c1
Sequence:CCGGCGCATTTATACGCGCACACAACTCGAGTTGTGTGCGCGTATAAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-239s1c1
Sequence:CCGGGAACCGTCAATACGAACCAAACTCGAGTTTGGTTCGTATTGACGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-74s1c1
Sequence:CCGGCAATCCGCTTTAAGGAGGATACTCGAGTATCCTCCTTAAAGCGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_070619
NKX2-6 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-228s1c1
Sequence:CCGGGCCCTTTAAGAGAACCGTCAACTCGAGTTGACGGTTCTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-1105s1c1
Sequence:CCGGCGACGCTACAAATGCAAGAGACTCGAGTCTCTTGCATTTGTAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-37s1c1
Sequence:CCGGCGCATTTATACGCGCACACAACTCGAGTTGTGTGCGCGTATAAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-239s1c1
Sequence:CCGGGAACCGTCAATACGAACCAAACTCGAGTTTGGTTCGTATTGACGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-74s1c1
Sequence:CCGGCAATCCGCTTTAAGGAGGATACTCGAGTATCCTCCTTAAAGCGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_070619
NKX2-6 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-228s1c1
Sequence:CCGGGCCCTTTAAGAGAACCGTCAACTCGAGTTGACGGTTCTCTTAAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-1105s1c1
Sequence:CCGGCGACGCTACAAATGCAAGAGACTCGAGTCTCTTGCATTTGTAGCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-37s1c1
Sequence:CCGGCGCATTTATACGCGCACACAACTCGAGTTGTGTGCGCGTATAAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-239s1c1
Sequence:CCGGGAACCGTCAATACGAACCAAACTCGAGTTTGGTTCGTATTGACGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_070619.7-74s1c1
Sequence:CCGGCAATCCGCTTTAAGGAGGATACTCGAGTATCCTCCTTAAAGCGGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010920
NKX2-6 MISSION shRNA Bacterial Glycerol Stock
NK2 homeobox 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010920.1-785s1c1
Sequence:CCGGCCTGAAGACCTTGAGAACATTCTCGAGAATGTTCTCAAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-39s1c1
Sequence:CCGGCCGGGCACGATCTCCCGACTTCTCGAGAAGTCGGGAGATCGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-121s1c1
Sequence:CCGGGCGGTCCGGTTTCAACCAGAACTCGAGTTCTGGTTGAAACCGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-495s1c1
Sequence:CCGGACTCCCTACGACGCTAGCTATCTCGAGATAGCTAGCGTCGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-303s1c1
Sequence:CCGGCGGCGCTACAAGTCCAAGAGTCTCGAGACTCTTGGACTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-436s21c1
Sequence:CCGGCATTCCTGGGTCCCTACAAAGCTCGAGCTTTGTAGGGACCCAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-467s21c1
Sequence:CCGGCTATTCCTGCTTCGGTGGCTACTCGAGTAGCCACCGAAGCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-380s21c1
Sequence:CCGGAGCAGTGCCAGTACTGGTACTCTCGAGAGTACCAGTACTGGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010920.1-660s21c1
Sequence:CCGGTGAGCTCACCTACTGCCATTCCTCGAGGAATGGCAGTAGGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010920
NKX2-6 MISSION shRNA shRNA Plasmid DNA
NK2 homeobox 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010920.1-785s1c1
Sequence:CCGGCCTGAAGACCTTGAGAACATTCTCGAGAATGTTCTCAAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-39s1c1
Sequence:CCGGCCGGGCACGATCTCCCGACTTCTCGAGAAGTCGGGAGATCGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-121s1c1
Sequence:CCGGGCGGTCCGGTTTCAACCAGAACTCGAGTTCTGGTTGAAACCGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-495s1c1
Sequence:CCGGACTCCCTACGACGCTAGCTATCTCGAGATAGCTAGCGTCGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-303s1c1
Sequence:CCGGCGGCGCTACAAGTCCAAGAGTCTCGAGACTCTTGGACTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-436s21c1
Sequence:CCGGCATTCCTGGGTCCCTACAAAGCTCGAGCTTTGTAGGGACCCAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-467s21c1
Sequence:CCGGCTATTCCTGCTTCGGTGGCTACTCGAGTAGCCACCGAAGCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-380s21c1
Sequence:CCGGAGCAGTGCCAGTACTGGTACTCTCGAGAGTACCAGTACTGGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010920.1-660s21c1
Sequence:CCGGTGAGCTCACCTACTGCCATTCCTCGAGGAATGGCAGTAGGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010920
NKX2-6 MISSION shRNA Lentiviral Transduction Particles
NK2 homeobox 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084813    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010920.1-785s1c1
Sequence:CCGGCCTGAAGACCTTGAGAACATTCTCGAGAATGTTCTCAAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-39s1c1
Sequence:CCGGCCGGGCACGATCTCCCGACTTCTCGAGAAGTCGGGAGATCGTGCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-121s1c1
Sequence:CCGGGCGGTCCGGTTTCAACCAGAACTCGAGTTCTGGTTGAAACCGGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-495s1c1
Sequence:CCGGACTCCCTACGACGCTAGCTATCTCGAGATAGCTAGCGTCGTAGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010920.1-303s1c1
Sequence:CCGGCGGCGCTACAAGTCCAAGAGTCTCGAGACTCTTGGACTTGTAGCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-436s21c1
Sequence:CCGGCATTCCTGGGTCCCTACAAAGCTCGAGCTTTGTAGGGACCCAGGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-467s21c1
Sequence:CCGGCTATTCCTGCTTCGGTGGCTACTCGAGTAGCCACCGAAGCAGGAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010920.1-380s21c1
Sequence:CCGGAGCAGTGCCAGTACTGGTACTCTCGAGAGTACCAGTACTGGCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416792    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010920.1-660s21c1
Sequence:CCGGTGAGCTCACCTACTGCCATTCCTCGAGGAATGGCAGTAGGTGAGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks