EMAIL THIS PAGE TO A FRIEND

NKX3-2

NK3 homeobox 2

Synonyms: BAPX1 NKX3.2 NKX3B SMMD
UniProtKB ID: P78367, Q2M2I7
Gene ID:
Human(579) Summary: This gene encodes a member of the NK family of homeobox-containing proteins. The encoded protein may play a role in skeletal development. [provided by RefSeq, Jul 2008]
Mouse(12020) NK3 homeobox 2
Rat(682329) NK3 homeobox 2
naked mole-rat(101726011) NK3 homeobox 2
sheep(101115541) NK3 homeobox 2
chicken(373932) NK3 homeobox 2
cow(616907) NK3 homeobox 2
dog(488822) NK3 homeobox 2
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36826 Anti-BAPX1 antibody produced in rabbit affinity isolated antibody canine, guinea pig, human, pig, rat, bovine, zebrafish, mouse, horse, rabbit
western blot pricing
SAB2101604 Anti-NKX3-2 (ab1) antibody produced in rabbit affinity isolated antibody human, bovine, guinea pig, rabbit, rat, canine, mouse
western blot pricing
SAB2101605 Anti-NKX3-2 (ab2) antibody produced in rabbit affinity isolated antibody canine, guinea pig, rabbit, mouse, bovine, human
western blot pricing
SAB2101606 Anti-NKX3-2 (ab3) antibody produced in rabbit affinity isolated antibody human, mouse, rabbit, rat, guinea pig, canine, bovine, zebrafish
western blot pricing
HPA027564 Anti-NKX3-2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105245 Anti-NKX3-2 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001189 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007524 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007524 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007524 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU056691 MISSION® esiRNA esiRNA human BAPX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001189 Rosetta Predictions human pricing
XM_001061045 Rosetta Predictions rat pricing
NM_007524 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229619 predicted 905
2 SASI_Hs01_00229620 predicted 1509
3 SASI_Hs01_00229621 predicted 904
4 SASI_Hs01_00229622 predicted 1514
5 SASI_Hs01_00229623 predicted 1510
6 SASI_Hs02_00331328 predicted 290
7 SASI_Hs01_00229624 predicted 1495
8 SASI_Hs02_00331329 predicted 105
9 SASI_Hs01_00229625 predicted 1000
10 SASI_Hs01_00229626 predicted 739
11 SASI_Hs01_00229627 predicted 12
12 SASI_Hs01_00229628 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298608 predicted 211
2 SASI_Rn02_00298609 predicted 399
3 SASI_Rn02_00298610 predicted 466
4 SASI_Rn02_00298611 predicted 201
5 SASI_Rn02_00298612 predicted 264
6 SASI_Rn02_00298613 predicted 465
7 SASI_Rn02_00298614 predicted 461
8 SASI_Rn02_00298615 predicted 241
9 SASI_Rn02_00298616 predicted 244
10 SASI_Rn02_00298617 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007524 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093172 predicted 1099
2 SASI_Mm01_00093173 predicted 1193
3 SASI_Mm01_00093174 predicted 1197
4 SASI_Mm02_00311833 predicted 1186
5 SASI_Mm01_00093175 predicted 1102
6 SASI_Mm01_00093177 predicted 486
7 SASI_Mm02_00311834 predicted 1130
8 SASI_Mm01_00093178 predicted 1200
9 SASI_Mm01_00093180 predicted 521
10 SASI_Mm02_00311835 predicted 550
11 SASI_Mm01_00093171 predicted 1152
12 SASI_Mm01_00093176 predicted 1132
13 SASI_Mm01_00093179 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001189
VALIDATED
NKX3-2 MISSION shRNA Bacterial Glycerol Stock
NK3 homeobox 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-669s1c1
Sequence:CCGGCCGCTTTAACCACCAGCGCTACTCGAGTAGCGCTGGTGGTTAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-43s1c1
Sequence:CCGGCAGGCGATCCTCAACAAGAAACTCGAGTTTCTTGTTGAGGATCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_001189.2-927s1c1
Sequence:CCGGCTCCTACTATTACCCGTACTACTCGAGTAGTACGGGTAATAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-403s1c1
Sequence:CCGGTCCAAAGACCTAGAGGAGGAACTCGAGTTCCTCCTCTAGGTCTTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001189.2-1438s1c1
Sequence:CCGGCCAATCTATGTGTATCTACATCTCGAGATGTAGATACACATAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1434s21c1
Sequence:CCGGACATAGCCTGAATCCTCAGAACTCGAGTTCTGAGGATTCAGGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1503s21c1
Sequence:CCGGTATCCATGCTACCAATCTATGCTCGAGCATAGATTGGTAGCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001189.3-843s21c1
Sequence:CCGGACCGTCGCTACAAGACAAAGCCTCGAGGCTTTGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1419s21c1
Sequence:CCGGCAACTCCTGGAGACCACATAGCTCGAGCTATGTGGTCTCCAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1549s21c1
Sequence:CCGGGAAATTGCATTTGTAACCAAGCTCGAGCTTGGTTACAAATGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1334s21c1
Sequence:CCGGTGGGCTCTATTTATTATCATGCTCGAGCATGATAATAAATAGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001189
VALIDATED
NKX3-2 MISSION shRNA shRNA Plasmid DNA
NK3 homeobox 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-669s1c1
Sequence:CCGGCCGCTTTAACCACCAGCGCTACTCGAGTAGCGCTGGTGGTTAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-43s1c1
Sequence:CCGGCAGGCGATCCTCAACAAGAAACTCGAGTTTCTTGTTGAGGATCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_001189.2-927s1c1
Sequence:CCGGCTCCTACTATTACCCGTACTACTCGAGTAGTACGGGTAATAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-403s1c1
Sequence:CCGGTCCAAAGACCTAGAGGAGGAACTCGAGTTCCTCCTCTAGGTCTTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001189.2-1438s1c1
Sequence:CCGGCCAATCTATGTGTATCTACATCTCGAGATGTAGATACACATAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1434s21c1
Sequence:CCGGACATAGCCTGAATCCTCAGAACTCGAGTTCTGAGGATTCAGGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1503s21c1
Sequence:CCGGTATCCATGCTACCAATCTATGCTCGAGCATAGATTGGTAGCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001189.3-843s21c1
Sequence:CCGGACCGTCGCTACAAGACAAAGCCTCGAGGCTTTGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1419s21c1
Sequence:CCGGCAACTCCTGGAGACCACATAGCTCGAGCTATGTGGTCTCCAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1549s21c1
Sequence:CCGGGAAATTGCATTTGTAACCAAGCTCGAGCTTGGTTACAAATGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1334s21c1
Sequence:CCGGTGGGCTCTATTTATTATCATGCTCGAGCATGATAATAAATAGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001189
VALIDATED
NKX3-2 MISSION shRNA Lentiviral Transduction Particles
NK3 homeobox 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-669s1c1
Sequence:CCGGCCGCTTTAACCACCAGCGCTACTCGAGTAGCGCTGGTGGTTAAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-43s1c1
Sequence:CCGGCAGGCGATCCTCAACAAGAAACTCGAGTTTCTTGTTGAGGATCGCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_001189.2-927s1c1
Sequence:CCGGCTCCTACTATTACCCGTACTACTCGAGTAGTACGGGTAATAGTAGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001189.2-403s1c1
Sequence:CCGGTCCAAAGACCTAGAGGAGGAACTCGAGTTCCTCCTCTAGGTCTTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001189.2-1438s1c1
Sequence:CCGGCCAATCTATGTGTATCTACATCTCGAGATGTAGATACACATAGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1434s21c1
Sequence:CCGGACATAGCCTGAATCCTCAGAACTCGAGTTCTGAGGATTCAGGCTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1503s21c1
Sequence:CCGGTATCCATGCTACCAATCTATGCTCGAGCATAGATTGGTAGCATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001189.3-843s21c1
Sequence:CCGGACCGTCGCTACAAGACAAAGCCTCGAGGCTTTGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1419s21c1
Sequence:CCGGCAACTCCTGGAGACCACATAGCTCGAGCTATGTGGTCTCCAGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1549s21c1
Sequence:CCGGGAAATTGCATTTGTAACCAAGCTCGAGCTTGGTTACAAATGCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428996    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001189.3-1334s21c1
Sequence:CCGGTGGGCTCTATTTATTATCATGCTCGAGCATGATAATAAATAGAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007524
NKX3-2 MISSION shRNA Bacterial Glycerol Stock
NK3 homeobox 2
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1135s1c1
Sequence:CCGGCGTGACGACCAAAGACTGTATCTCGAGATACAGTCTTTGGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1203s1c1
Sequence:CCGGCTCCTACTACTACCCTTACTACTCGAGTAGTAAGGGTAGTAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-719s1c1
Sequence:CCGGGCGAGATGTCAGCCAGCGTTTCTCGAGAAACGCTGGCTGACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1008s1c1
Sequence:CCGGGCTCACAGAGACGCAAGTGAACTCGAGTTCACTTGCGTCTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-475s21c1
Sequence:CCGGGAGGACTCTCTTCTGGCATCTCTCGAGAGATGCCAGAAGAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-1043s21c1
Sequence:CCGGACCGTCGCTACAAGACCAAACCTCGAGGTTTGGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007524
NKX3-2 MISSION shRNA shRNA Plasmid DNA
NK3 homeobox 2
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1135s1c1
Sequence:CCGGCGTGACGACCAAAGACTGTATCTCGAGATACAGTCTTTGGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1203s1c1
Sequence:CCGGCTCCTACTACTACCCTTACTACTCGAGTAGTAAGGGTAGTAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-719s1c1
Sequence:CCGGGCGAGATGTCAGCCAGCGTTTCTCGAGAAACGCTGGCTGACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1008s1c1
Sequence:CCGGGCTCACAGAGACGCAAGTGAACTCGAGTTCACTTGCGTCTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-475s21c1
Sequence:CCGGGAGGACTCTCTTCTGGCATCTCTCGAGAGATGCCAGAAGAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-1043s21c1
Sequence:CCGGACCGTCGCTACAAGACCAAACCTCGAGGTTTGGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007524
NKX3-2 MISSION shRNA Lentiviral Transduction Particles
NK3 homeobox 2
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1135s1c1
Sequence:CCGGCGTGACGACCAAAGACTGTATCTCGAGATACAGTCTTTGGTCGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1203s1c1
Sequence:CCGGCTCCTACTACTACCCTTACTACTCGAGTAGTAAGGGTAGTAGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-719s1c1
Sequence:CCGGGCGAGATGTCAGCCAGCGTTTCTCGAGAAACGCTGGCTGACATCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007524.1-1008s1c1
Sequence:CCGGGCTCACAGAGACGCAAGTGAACTCGAGTTCACTTGCGTCTCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-475s21c1
Sequence:CCGGGAGGACTCTCTTCTGGCATCTCTCGAGAGATGCCAGAAGAGAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007524.3-1043s21c1
Sequence:CCGGACCGTCGCTACAAGACCAAACCTCGAGGTTTGGTCTTGTAGCGACGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks