EMAIL THIS PAGE TO A FRIEND

NLGN1

neuroligin 1

Synonyms: NL1
UniProtKB ID: Q8N2Q7, Q9UPT2
Gene ID:
Human(22871) Summary: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
Mouse(192167) neuroligin 1
Rat(116647) neuroligin 1
Zebrafish(100002610) neuroligin 1
dog(488173) neuroligin 1
cow(530042) neuroligin 1
Horse(100058013) neuroligin 1
chicken(424980) neuroligin 1
sheep(101112016) neuroligin 1
184 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407153 Anti-NLGN1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA006680 Anti-NLGN1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB5201473 Monoclonal Anti-Neuroligin - Alkaline Phosphatase antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201474 Monoclonal Anti-Neuroligin - Apc antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201465 Monoclonal Anti-Neuroligin - Atto 390 antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201466 Monoclonal Anti-Neuroligin - Atto 488 antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201467 Monoclonal Anti-Neuroligin - Atto 565 antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201468 Monoclonal Anti-Neuroligin - Atto 594 antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201469 Monoclonal Anti-Neuroligin - Atto 633 antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201470 Monoclonal Anti-Neuroligin - Atto 655 antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201471 Monoclonal Anti-Neuroligin - Atto 680 antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201472 Monoclonal Anti-Neuroligin - Atto 700 antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201475 Monoclonal Anti-Neuroligin - Biotin antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201476 Monoclonal Anti-Neuroligin - Fitc antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201477 Monoclonal Anti-Neuroligin - Hrp antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201478 Monoclonal Anti-Neuroligin - Pe/Atto 594 antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201479 Monoclonal Anti-Neuroligin - Percp antibody produced in mouse clone S97A-31, purified immunoglobulin rat, mouse
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201480 Monoclonal Anti-Neuroligin - Rpe antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201481 Monoclonal Anti-Neuroligin - Streptavidin antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
SAB5201464 Monoclonal Anti-Neuroligin 1 antibody produced in mouse clone S97A-31, purified immunoglobulin mouse, rat
immunocytochemistry, immunohistochemistry, western blot pricing
WH0022871M1 Monoclonal Anti-NLGN1 antibody produced in mouse clone 2G7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404939 Monoclonal Anti-NLGN1 antibody produced in mouse clone 1D6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138666 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138666 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138666 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152031 MISSION® esiRNA esiRNA human NLGN1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014932 Rosetta Predictions human pricing
NM_053868 Rosetta Predictions rat pricing
NM_138666 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014932 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143604 predicted 509
2 SASI_Hs02_00346591 predicted 1037
3 SASI_Hs01_00143605 predicted 443
4 SASI_Hs01_00143606 predicted 835
5 SASI_Hs01_00143607 predicted 1629
6 SASI_Hs01_00143608 predicted 1127
7 SASI_Hs01_00143609 predicted 2110
8 SASI_Hs01_00143610 predicted 2100
9 SASI_Hs01_00143611 predicted 2306
10 SASI_Hs01_00143612 predicted 1227
11 SASI_Hs01_00143613 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053868 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073036 predicted 1787
2 SASI_Rn01_00073037 predicted 1503
3 SASI_Rn02_00266755 predicted 927
4 SASI_Rn02_00266756 predicted 932
5 SASI_Rn01_00073038 predicted 1672
6 SASI_Rn02_00266757 predicted 1869
7 SASI_Rn01_00073039 predicted 1670
8 SASI_Rn01_00073040 predicted 490
9 SASI_Rn01_00073042 predicted 1743
10 SASI_Rn01_00073043 predicted 1495
11 SASI_Rn01_00073041 predicted 1662
12 SASI_Rn01_00073044 predicted 2461
13 SASI_Rn01_00073045 predicted 1538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161480 predicted 2613
2 SASI_Mm01_00161481 predicted 1743
3 SASI_Mm01_00161482 predicted 3151
4 SASI_Mm01_00161483 predicted 2498
5 SASI_Mm01_00161484 predicted 2698
6 SASI_Mm01_00161485 predicted 2969
7 SASI_Mm01_00161486 predicted 1309
8 SASI_Mm01_00161487 predicted 3140
9 SASI_Mm01_00161488 predicted 1467
10 SASI_Mm01_00161489 predicted 2000
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138666
NLGN1 MISSION shRNA Bacterial Glycerol Stock
neuroligin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3715s1c1
Sequence:CCGGCCCAACACTATACCAGGGATTCTCGAGAATCCCTGGTATAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2779s1c1
Sequence:CCGGGCAGACCTTCACTCGAACTTTCTCGAGAAAGTTCGAGTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2116s1c1
Sequence:CCGGCCCTTGCGAATCACTGTGTTTCTCGAGAAACACAGTGATTCGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3450s1c1
Sequence:CCGGCCTGTACTACAAGAAGGATAACTCGAGTTATCCTTCTTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000032023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2374s1c1
Sequence:CCGGCCTTACAAAGAACTTGTTGATCTCGAGATCAACAAGTTCTTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138666
NLGN1 MISSION shRNA shRNA Plasmid DNA
neuroligin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3715s1c1
Sequence:CCGGCCCAACACTATACCAGGGATTCTCGAGAATCCCTGGTATAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2779s1c1
Sequence:CCGGGCAGACCTTCACTCGAACTTTCTCGAGAAAGTTCGAGTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2116s1c1
Sequence:CCGGCCCTTGCGAATCACTGTGTTTCTCGAGAAACACAGTGATTCGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3450s1c1
Sequence:CCGGCCTGTACTACAAGAAGGATAACTCGAGTTATCCTTCTTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000032023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2374s1c1
Sequence:CCGGCCTTACAAAGAACTTGTTGATCTCGAGATCAACAAGTTCTTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138666
NLGN1 MISSION shRNA Lentiviral Transduction Particles
neuroligin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3715s1c1
Sequence:CCGGCCCAACACTATACCAGGGATTCTCGAGAATCCCTGGTATAGTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2779s1c1
Sequence:CCGGGCAGACCTTCACTCGAACTTTCTCGAGAAAGTTCGAGTGAAGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2116s1c1
Sequence:CCGGCCCTTGCGAATCACTGTGTTTCTCGAGAAACACAGTGATTCGCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-3450s1c1
Sequence:CCGGCCTGTACTACAAGAAGGATAACTCGAGTTATCCTTCTTGTAGTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000032023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138666.2-2374s1c1
Sequence:CCGGCCTTACAAAGAACTTGTTGATCTCGAGATCAACAAGTTCTTTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks