EMAIL THIS PAGE TO A FRIEND

NLGN2

neuroligin 2

UniProtKB ID: Q8NFZ4, Q9P2I1
Gene ID:
Human(57555) Summary: This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
Mouse(216856) neuroligin 2
Rat(117096) neuroligin 2
cow(787986) neuroligin 2
Horse(100072981) neuroligin 2
dog(479482) neuroligin 2
sheep(101120588) neuroligin 2
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020795 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020795 Rosetta Predictions human pricing
NM_053992 Rosetta Predictions rat pricing
NM_198862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124397 predicted 872
2 SASI_Hs01_00124398 predicted 1837
3 SASI_Hs01_00124399 predicted 891
4 SASI_Hs01_00124400 predicted 540
5 SASI_Hs01_00124401 predicted 1571
6 SASI_Hs01_00124403 predicted 1030
7 SASI_Hs01_00124404 predicted 1176
8 SASI_Hs01_00124405 predicted 642
9 SASI_Hs01_00124406 predicted 841
10 SASI_Hs02_00353956 predicted 1768
11 SASI_Hs01_00124402 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069207 predicted 1656
2 SASI_Rn01_00069208 predicted 2318
3 SASI_Rn01_00069210 predicted 1073
4 SASI_Rn01_00069211 predicted 1890
5 SASI_Rn01_00069212 predicted 1355
6 SASI_Rn01_00069213 predicted 1638
7 SASI_Rn01_00069214 predicted 1791
8 SASI_Rn01_00069215 predicted 2245
9 SASI_Rn01_00069216 predicted 2261
10 SASI_Rn02_00266987 predicted 1663
11 SASI_Rn01_00069209 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150444 predicted 1635
2 SASI_Mm02_00351181 predicted 1223
3 SASI_Mm01_00150445 predicted 1217
4 SASI_Mm01_00150446 predicted 929
5 SASI_Mm02_00351182 predicted 1568
6 SASI_Mm02_00351183 predicted 1156
7 SASI_Mm01_00150449 predicted 1655
8 SASI_Mm01_00150450 predicted 1021
9 SASI_Mm01_00150451 predicted 988
10 SASI_Mm01_00150453 predicted 2143
11 SASI_Mm01_00150447 predicted 1381
12 SASI_Mm01_00150448 predicted 1528
13 SASI_Mm01_00150452 predicted 1354
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198862
VALIDATED
NLGN2 MISSION shRNA Bacterial Glycerol Stock
neuroligin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-643s1c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198862.1-523s1c1
Sequence:CCGGGCGCAGTAGTCATGACCTATTCTCGAGAATAGGTCATGACTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198862.1-892s1c1
Sequence:CCGGCTGATATTGACCTAGGCCCAACTCGAGTTGGGCCTAGGTCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-665s1c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198862.1-1720s1c1
Sequence:CCGGGCCCATGTGAAGACATGCTTTCTCGAGAAAGCATGTCTTCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198862.2-3373s21c1
Sequence:CCGGTTTGCCTCCTCCAAGAATTTCCTCGAGGAAATTCTTGGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2004s21c1
Sequence:CCGGCGCAGTAGTCATGACCTATTGCTCGAGCAATAGGTCATGACTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2123s21c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-1178s21c1
Sequence:CCGGCTGAACGCATCACTATCTTTGCTCGAGCAAAGATAGTGATGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2145s21c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198862
VALIDATED
NLGN2 MISSION shRNA shRNA Plasmid DNA
neuroligin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-643s1c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198862.1-523s1c1
Sequence:CCGGGCGCAGTAGTCATGACCTATTCTCGAGAATAGGTCATGACTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198862.1-892s1c1
Sequence:CCGGCTGATATTGACCTAGGCCCAACTCGAGTTGGGCCTAGGTCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-665s1c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198862.1-1720s1c1
Sequence:CCGGGCCCATGTGAAGACATGCTTTCTCGAGAAAGCATGTCTTCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198862.2-3373s21c1
Sequence:CCGGTTTGCCTCCTCCAAGAATTTCCTCGAGGAAATTCTTGGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2004s21c1
Sequence:CCGGCGCAGTAGTCATGACCTATTGCTCGAGCAATAGGTCATGACTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2123s21c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-1178s21c1
Sequence:CCGGCTGAACGCATCACTATCTTTGCTCGAGCAAAGATAGTGATGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2145s21c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198862
VALIDATED
NLGN2 MISSION shRNA Lentiviral Transduction Particles
neuroligin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-643s1c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196058    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198862.1-523s1c1
Sequence:CCGGGCGCAGTAGTCATGACCTATTCTCGAGAATAGGTCATGACTACTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198862.1-892s1c1
Sequence:CCGGCTGATATTGACCTAGGCCCAACTCGAGTTGGGCCTAGGTCAATATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_198862.1-665s1c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184175    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198862.1-1720s1c1
Sequence:CCGGGCCCATGTGAAGACATGCTTTCTCGAGAAAGCATGTCTTCACATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328714    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198862.2-3373s21c1
Sequence:CCGGTTTGCCTCCTCCAAGAATTTCCTCGAGGAAATTCTTGGAGGAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2004s21c1
Sequence:CCGGCGCAGTAGTCATGACCTATTGCTCGAGCAATAGGTCATGACTACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2123s21c1
Sequence:CCGGGCAAGTTCAACAGCAAGGAAACTCGAGTTTCCTTGCTGTTGAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-1178s21c1
Sequence:CCGGCTGAACGCATCACTATCTTTGCTCGAGCAAAGATAGTGATGCGTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198862.2-2145s21c1
Sequence:CCGGGCAGTATCTGCACATAGGCTTCTCGAGAAGCCTATGTGCAGATACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020795
NLGN2 MISSION shRNA Bacterial Glycerol Stock
neuroligin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020795.2-4073s1c1
Sequence:CCGGCCAGCAGGAATAATTTGAAATCTCGAGATTTCAAATTATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-839s1c1
Sequence:CCGGCCCGAGCGTATCACCATCTTTCTCGAGAAAGATGGTGATACGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1351s1c1
Sequence:CCGGGCTTCGGGAGACCATCAAGTTCTCGAGAACTTGATGGTCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1192s1c1
Sequence:CCGGCCTCAACTACGACATGCTCATCTCGAGATGAGCATGTCGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1802s1c1
Sequence:CCGGGAGAAGCAGTATCTGCACATACTCGAGTATGTGCAGATACTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020795
NLGN2 MISSION shRNA shRNA Plasmid DNA
neuroligin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020795.2-4073s1c1
Sequence:CCGGCCAGCAGGAATAATTTGAAATCTCGAGATTTCAAATTATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-839s1c1
Sequence:CCGGCCCGAGCGTATCACCATCTTTCTCGAGAAAGATGGTGATACGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1351s1c1
Sequence:CCGGGCTTCGGGAGACCATCAAGTTCTCGAGAACTTGATGGTCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1192s1c1
Sequence:CCGGCCTCAACTACGACATGCTCATCTCGAGATGAGCATGTCGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1802s1c1
Sequence:CCGGGAGAAGCAGTATCTGCACATACTCGAGTATGTGCAGATACTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020795
NLGN2 MISSION shRNA Lentiviral Transduction Particles
neuroligin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020795.2-4073s1c1
Sequence:CCGGCCAGCAGGAATAATTTGAAATCTCGAGATTTCAAATTATTCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-839s1c1
Sequence:CCGGCCCGAGCGTATCACCATCTTTCTCGAGAAAGATGGTGATACGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1351s1c1
Sequence:CCGGGCTTCGGGAGACCATCAAGTTCTCGAGAACTTGATGGTCTCCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1192s1c1
Sequence:CCGGCCTCAACTACGACATGCTCATCTCGAGATGAGCATGTCGTAGTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020795.2-1802s1c1
Sequence:CCGGGAGAAGCAGTATCTGCACATACTCGAGTATGTGCAGATACTGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks