EMAIL THIS PAGE TO A FRIEND

NLRC3

NLR family, CARD domain containing 3

Synonyms: CLR16.2 NOD3
UniProtKB ID: Q7RTR2, Q5EY36, Q8NF48, Q8NI01, Q8NI02, Q8TEL3
Gene ID:
Human(197358) Summary: The protein encoded by this gene is a cytosolic regulator of innate immunity. The encoded protein contains several leucine-rich repeat domains and may be involved in regulating T-cell activation. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Feb 2013]
Mouse(268857) NLR family, CARD domain containing 3
Rat(287070) NLR family, CARD domain containing 3
Zebrafish(568962) NLR family, CARD domain containing 3
dog(490033) NLR family, CARD domain containing 3
domestic cat(101096437) NLR family, CARD domain containing 3
Horse(100069521) NLR family, CARD domain containing 3
cow(507786) NLR family, CARD domain containing 3
chicken(416673) NLR family, CARD domain containing 3
domestic guinea pig(100716208) NLR family, CARD domain containing 3
naked mole-rat(101709468) NLR family, CARD domain containing 3
sheep(101122829) NLR family, CARD domain containing 3
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175547 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175547 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175547 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178844 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178844 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178844 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178844 Rosetta Predictions human pricing
XM_001077479 Rosetta Predictions rat pricing
XM_220212 Rosetta Predictions rat pricing
NM_001081280 Rosetta Predictions mouse pricing
XM_484522 Rosetta Predictions mouse pricing
XM_884556 Rosetta Predictions mouse pricing
XM_895649 Rosetta Predictions mouse pricing
XM_895674 Rosetta Predictions mouse pricing
XM_895695 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178844 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026564 predicted 1786
2 SASI_Hs01_00026565 predicted 1495
3 SASI_Hs01_00026567 predicted 3337
4 SASI_Hs02_00369894 predicted 3387
5 SASI_Hs02_00369895 predicted 3508
6 SASI_Hs01_00026568 predicted 2759
7 SASI_Hs01_00026569 predicted 3343
8 SASI_Hs02_00369896 predicted 3491
9 SASI_Hs01_00026571 predicted 1152
10 SASI_Hs02_00369897 predicted 3618
11 SASI_Hs01_00026566 predicted 1773
12 SASI_Hs01_00026570 predicted 1636
13 SASI_Hs01_00026572 predicted 3133
14 SASI_Hs01_00026573 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357195 predicted 2078
2 SASI_Rn02_00357196 predicted 2758
3 SASI_Rn02_00357197 predicted 1071
4 SASI_Rn02_00357198 predicted 1116
5 SASI_Rn02_00357199 predicted 2589
6 SASI_Rn02_00357200 predicted 1150
7 SASI_Rn02_00357201 predicted 902
8 SASI_Rn02_00357202 predicted 2901
9 SASI_Rn02_00357203 predicted 517
10 SASI_Rn02_00357204 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379115 predicted 2077
2 SASI_Rn02_00379116 predicted 2752
3 SASI_Rn02_00379117 predicted 1067
4 SASI_Rn02_00379118 predicted 1115
5 SASI_Rn02_00379119 predicted 2587
6 SASI_Rn02_00379120 predicted 1148
7 SASI_Rn02_00379121 predicted 908
8 SASI_Rn02_00379122 predicted 2906
9 SASI_Rn02_00379123 predicted 518
10 SASI_Rn02_00379124 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296927 predicted 905
2 SASI_Mm02_00296928 predicted 1284
3 SASI_Mm02_00296929 predicted 3348
4 SASI_Mm02_00296930 predicted 1735
5 SASI_Mm02_00296931 predicted 1884
6 SASI_Mm02_00296932 predicted 2638
7 SASI_Mm02_00296933 predicted 2215
8 SASI_Mm02_00296934 predicted 2802
9 SASI_Mm02_00296935 predicted 3135
10 SASI_Mm02_00296936 predicted 2715
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_484522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239156 predicted 3791
2 SASI_Mm01_00239157 predicted 3888
3 SASI_Mm01_00239158 predicted 3466
4 SASI_Mm01_00239159 predicted 3943
5 SASI_Mm01_00239160 predicted 3634
6 SASI_Mm01_00239161 predicted 3816
7 SASI_Mm01_00239162 predicted 3654
8 SASI_Mm01_00239163 predicted 3817
9 SASI_Mm01_00239164 predicted 3737
10 SASI_Mm01_00239165 predicted 3861
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884556 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273369 predicted 902
2 SASI_Mm01_00273370 predicted 1286
3 SASI_Mm01_00273371 predicted 3356
4 SASI_Mm01_00273372 predicted 1743
5 SASI_Mm01_00273373 predicted 2642
6 SASI_Mm01_00273374 predicted 2220
7 SASI_Mm01_00273375 predicted 3135
8 SASI_Mm01_00273376 predicted 2724
9 SASI_Mm01_00273377 predicted 3385
10 SASI_Mm01_00273378 predicted 1653
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246817 predicted 591
2 SASI_Mm01_00246818 predicted 357
3 SASI_Mm01_00246819 predicted 463
4 SASI_Mm01_00246820 predicted 418
5 SASI_Mm01_00246821 predicted 581
6 SASI_Mm01_00246822 predicted 433
7 SASI_Mm01_00246823 predicted 603
8 SASI_Mm01_00246824 predicted 585
9 SASI_Mm01_00246825 predicted 417
10 SASI_Mm01_00246826 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00239787 predicted 632
2 SASI_Mm01_00239788 predicted 728
3 SASI_Mm01_00239789 predicted 310
4 SASI_Mm01_00239790 predicted 780
5 SASI_Mm01_00239791 predicted 468
6 SASI_Mm01_00239792 predicted 649
7 SASI_Mm01_00239793 predicted 490
8 SASI_Mm01_00239794 predicted 658
9 SASI_Mm01_00239795 predicted 568
10 SASI_Mm01_00239796 predicted 689
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895695 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00205766 predicted 1188
2 SASI_Mm01_00205767 predicted 230
3 SASI_Mm01_00205768 predicted 1184
4 SASI_Mm01_00205769 predicted 812
5 SASI_Mm01_00205770 predicted 474
6 SASI_Mm01_00205771 predicted 643
7 SASI_Mm01_00205772 predicted 975
8 SASI_Mm01_00205773 predicted 558
9 SASI_Mm01_00205774 predicted 1496
10 SASI_Mm01_00205775 predicted 536
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175547
NLRC3 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 3
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000176177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-645s1c1
Sequence:CCGGGAGCAATTCCATCAGTGACATCTCGAGATGTCACTGATGGAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-469s1c1
Sequence:CCGGCAGCTACAGAAGAACTTAATTCTCGAGAATTAAGTTCTTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175547
NLRC3 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 3
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000176177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-645s1c1
Sequence:CCGGGAGCAATTCCATCAGTGACATCTCGAGATGTCACTGATGGAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-469s1c1
Sequence:CCGGCAGCTACAGAAGAACTTAATTCTCGAGAATTAAGTTCTTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175547
NLRC3 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 3
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000176177    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-645s1c1
Sequence:CCGGGAGCAATTCCATCAGTGACATCTCGAGATGTCACTGATGGAATTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175237    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175547.2-469s1c1
Sequence:CCGGCAGCTACAGAAGAACTTAATTCTCGAGAATTAAGTTCTTCTGTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178844
NLRC3 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-2560s1c1
Sequence:CCGGGAGCTCATGTTCTCCAGTAATCTCGAGATTACTGGAGAACATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-389s1c1
Sequence:CCGGGCAATGACTCAAGGATACAGACTCGAGTCTGTATCCTTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-980s1c1
Sequence:CCGGGCAACCTCTTTCCGGAAGTTTCTCGAGAAACTTCCGGAAAGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3153s1c1
Sequence:CCGGCGACTTAAGAGGAAATGCCATCTCGAGATGGCATTTCCTCTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3130s1c1
Sequence:CCGGGTGAACAGAACCTTGGAGATTCTCGAGAATCTCCAAGGTTCTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-1496s21c1
Sequence:CCGGAGCTCTACTCATGGTACTTTACTCGAGTAAAGTACCATGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-2757s21c1
Sequence:CCGGGCTCATGTTCTCCAGTAATAGCTCGAGCTATTACTGGAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-3335s21c1
Sequence:CCGGCCTTGGAGATTCTCGACTTAACTCGAGTTAAGTCGAGAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178844
NLRC3 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-2560s1c1
Sequence:CCGGGAGCTCATGTTCTCCAGTAATCTCGAGATTACTGGAGAACATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-389s1c1
Sequence:CCGGGCAATGACTCAAGGATACAGACTCGAGTCTGTATCCTTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-980s1c1
Sequence:CCGGGCAACCTCTTTCCGGAAGTTTCTCGAGAAACTTCCGGAAAGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3153s1c1
Sequence:CCGGCGACTTAAGAGGAAATGCCATCTCGAGATGGCATTTCCTCTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3130s1c1
Sequence:CCGGGTGAACAGAACCTTGGAGATTCTCGAGAATCTCCAAGGTTCTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-1496s21c1
Sequence:CCGGAGCTCTACTCATGGTACTTTACTCGAGTAAAGTACCATGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-2757s21c1
Sequence:CCGGGCTCATGTTCTCCAGTAATAGCTCGAGCTATTACTGGAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-3335s21c1
Sequence:CCGGCCTTGGAGATTCTCGACTTAACTCGAGTTAAGTCGAGAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178844
NLRC3 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168587    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-2560s1c1
Sequence:CCGGGAGCTCATGTTCTCCAGTAATCTCGAGATTACTGGAGAACATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-389s1c1
Sequence:CCGGGCAATGACTCAAGGATACAGACTCGAGTCTGTATCCTTGAGTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168401    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-980s1c1
Sequence:CCGGGCAACCTCTTTCCGGAAGTTTCTCGAGAAACTTCCGGAAAGAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168194    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3153s1c1
Sequence:CCGGCGACTTAAGAGGAAATGCCATCTCGAGATGGCATTTCCTCTTAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168383    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178844.1-3130s1c1
Sequence:CCGGGTGAACAGAACCTTGGAGATTCTCGAGAATCTCCAAGGTTCTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-1496s21c1
Sequence:CCGGAGCTCTACTCATGGTACTTTACTCGAGTAAAGTACCATGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-2757s21c1
Sequence:CCGGGCTCATGTTCTCCAGTAATAGCTCGAGCTATTACTGGAGAACATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178844.2-3335s21c1
Sequence:CCGGCCTTGGAGATTCTCGACTTAACTCGAGTTAAGTCGAGAATCTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081280
NLRC3 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1751s21c1
Sequence:CCGGTGGCAGCTACATATTACTATACTCGAGTATAGTAATATGTAGCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3452s21c1
Sequence:CCGGACCACGGTCTGCACCATATTACTCGAGTAATATGGTGCAGACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1830s21c1
Sequence:CCGGACTGGGTTTCCTCGCCCATTTCTCGAGAAATGGGCGAGGAAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1451s21c1
Sequence:CCGGAGCTCTACTCTTGGTACTTTACTCGAGTAAAGTACCAAGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3122s21c1
Sequence:CCGGCCCTGACAACCTTAGACTTACCTCGAGGTAAGTCTAAGGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3803s21c1
Sequence:CCGGCTCAGGAGCAAAGTCTCAAAGCTCGAGCTTTGAGACTTTGCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1130s21c1
Sequence:CCGGGCAACCTCTTTCCAGAAATTTCTCGAGAAATTTCTGGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3839s21c1
Sequence:CCGGGGTTGGTCCTGGCTTACTCATCTCGAGATGAGTAAGCCAGGACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081280
NLRC3 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1751s21c1
Sequence:CCGGTGGCAGCTACATATTACTATACTCGAGTATAGTAATATGTAGCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3452s21c1
Sequence:CCGGACCACGGTCTGCACCATATTACTCGAGTAATATGGTGCAGACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1830s21c1
Sequence:CCGGACTGGGTTTCCTCGCCCATTTCTCGAGAAATGGGCGAGGAAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1451s21c1
Sequence:CCGGAGCTCTACTCTTGGTACTTTACTCGAGTAAAGTACCAAGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3122s21c1
Sequence:CCGGCCCTGACAACCTTAGACTTACCTCGAGGTAAGTCTAAGGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3803s21c1
Sequence:CCGGCTCAGGAGCAAAGTCTCAAAGCTCGAGCTTTGAGACTTTGCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1130s21c1
Sequence:CCGGGCAACCTCTTTCCAGAAATTTCTCGAGAAATTTCTGGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3839s21c1
Sequence:CCGGGGTTGGTCCTGGCTTACTCATCTCGAGATGAGTAAGCCAGGACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081280
NLRC3 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1751s21c1
Sequence:CCGGTGGCAGCTACATATTACTATACTCGAGTATAGTAATATGTAGCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3452s21c1
Sequence:CCGGACCACGGTCTGCACCATATTACTCGAGTAATATGGTGCAGACCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1830s21c1
Sequence:CCGGACTGGGTTTCCTCGCCCATTTCTCGAGAAATGGGCGAGGAAACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1451s21c1
Sequence:CCGGAGCTCTACTCTTGGTACTTTACTCGAGTAAAGTACCAAGAGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-3122s21c1
Sequence:CCGGCCCTGACAACCTTAGACTTACCTCGAGGTAAGTCTAAGGTTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3803s21c1
Sequence:CCGGCTCAGGAGCAAAGTCTCAAAGCTCGAGCTTTGAGACTTTGCTCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081280.1-1130s21c1
Sequence:CCGGGCAACCTCTTTCCAGAAATTTCTCGAGAAATTTCTGGAAAGAGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362598    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081280.1-3839s21c1
Sequence:CCGGGGTTGGTCCTGGCTTACTCATCTCGAGATGAGTAAGCCAGGACCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks