EMAIL THIS PAGE TO A FRIEND

NLRC5

NLR family, CARD domain containing 5

Synonyms: CLR16.1 NOD27 NOD4
Gene ID:
Human(84166) Summary: This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]
Mouse(434341) NLR family, CARD domain containing 5
Rat(291861) NLR family, CARD domain containing 5
chicken(100857413) NLR family, CARD domain containing 5
cow(782441) NLR family, CARD domain containing 5
Horse(100052017) NLR family, CARD domain containing 5
domestic cat(101083130) NLR family, CARD domain containing 5
dog(487268) NLR family, CARD domain containing 5
naked mole-rat(101702725) NLR family, CARD domain containing 5
sheep(101119413) NLR family, CARD domain containing 5
119 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032206 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032206 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032206 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032206 Rosetta Predictions human pricing
XM_001062196 Rosetta Predictions rat pricing
XM_214630 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032206 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359503 predicted 293
2 SASI_Hs01_00191924 predicted 849
3 SASI_Hs01_00191925 predicted 1519
4 SASI_Hs01_00191926 predicted 4982
5 SASI_Hs01_00191928 predicted 1655
6 SASI_Hs01_00191929 predicted 1695
7 SASI_Hs01_00191931 predicted 3470
8 SASI_Hs02_00359504 predicted 341
9 SASI_Hs01_00191932 predicted 4804
10 SASI_Hs01_00191933 predicted 623
11 SASI_Hs01_00191927 predicted 3435
12 SASI_Hs01_00191930 predicted 3608
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302622 predicted 3754
2 SASI_Rn02_00302623 predicted 2864
3 SASI_Rn02_00302624 predicted 3750
4 SASI_Rn02_00302625 predicted 4037
5 SASI_Rn02_00302626 predicted 1897
6 SASI_Rn02_00302627 predicted 4521
7 SASI_Rn02_00302628 predicted 2943
8 SASI_Rn02_00302629 predicted 1867
9 SASI_Rn02_00302630 predicted 2236
10 SASI_Rn02_00302631 predicted 2568
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375455 predicted 563
2 SASI_Rn02_00375456 predicted 2993
3 SASI_Rn02_00375457 predicted 3031
4 SASI_Rn02_00375458 predicted 2098
5 SASI_Rn02_00375459 predicted 2019
6 SASI_Rn02_00375460 predicted 2226
7 SASI_Rn02_00375461 predicted 2180
8 SASI_Rn02_00375462 predicted 3239
9 SASI_Rn02_00375463 predicted 1463
10 SASI_Rn02_00375464 predicted 1798
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032206
NLRC5 MISSION shRNA Bacterial Glycerol Stock
NLR family, CARD domain containing 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-168s1c1
Sequence:CCGGGCAACTCAACAAGCTGCATGTCTCGAGACATGCAGCTTGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-5314s1c1
Sequence:CCGGGTAATCTTGCTGTCCTGGAATCTCGAGATTCCAGGACAGCAAGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-2059s1c1
Sequence:CCGGCAGATAGAGAATCTCAGCTTTCTCGAGAAAGCTGAGATTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-3603s1c1
Sequence:CCGGGCACCATGCAACTTTGCACTTCTCGAGAAGTGCAAAGTTGCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-2058s1c1
Sequence:CCGGGCAGATAGAGAATCTCAGCTTCTCGAGAAGCTGAGATTCTCTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-5246s1c1
Sequence:CCGGCCTGTAAGATTGACAACCAGACTCGAGTCTGGTTGTCAATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-4703s1c1
Sequence:CCGGCCTTGCTTACTCACAGACTAACTCGAGTTAGTCTGTGAGTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-5882s21c1
Sequence:CCGGTTTCGCCCACTGGGATAATTGCTCGAGCAATTATCCCAGTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-6213s21c1
Sequence:CCGGACATGATTGTTGGTCTATATACTCGAGTATATAGACCAACAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032206.3-4802s21c1
Sequence:CCGGAGCTGGACTTGTCTAACAATCCTCGAGGATTGTTAGACAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032206
NLRC5 MISSION shRNA shRNA Plasmid DNA
NLR family, CARD domain containing 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-168s1c1
Sequence:CCGGGCAACTCAACAAGCTGCATGTCTCGAGACATGCAGCTTGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-5314s1c1
Sequence:CCGGGTAATCTTGCTGTCCTGGAATCTCGAGATTCCAGGACAGCAAGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-2059s1c1
Sequence:CCGGCAGATAGAGAATCTCAGCTTTCTCGAGAAAGCTGAGATTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-3603s1c1
Sequence:CCGGGCACCATGCAACTTTGCACTTCTCGAGAAGTGCAAAGTTGCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-2058s1c1
Sequence:CCGGGCAGATAGAGAATCTCAGCTTCTCGAGAAGCTGAGATTCTCTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-5246s1c1
Sequence:CCGGCCTGTAAGATTGACAACCAGACTCGAGTCTGGTTGTCAATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-4703s1c1
Sequence:CCGGCCTTGCTTACTCACAGACTAACTCGAGTTAGTCTGTGAGTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-5882s21c1
Sequence:CCGGTTTCGCCCACTGGGATAATTGCTCGAGCAATTATCCCAGTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-6213s21c1
Sequence:CCGGACATGATTGTTGGTCTATATACTCGAGTATATAGACCAACAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032206.3-4802s21c1
Sequence:CCGGAGCTGGACTTGTCTAACAATCCTCGAGGATTGTTAGACAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032206
NLRC5 MISSION shRNA Lentiviral Transduction Particles
NLR family, CARD domain containing 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-168s1c1
Sequence:CCGGGCAACTCAACAAGCTGCATGTCTCGAGACATGCAGCTTGTTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-5314s1c1
Sequence:CCGGGTAATCTTGCTGTCCTGGAATCTCGAGATTCCAGGACAGCAAGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-2059s1c1
Sequence:CCGGCAGATAGAGAATCTCAGCTTTCTCGAGAAAGCTGAGATTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-3603s1c1
Sequence:CCGGGCACCATGCAACTTTGCACTTCTCGAGAAGTGCAAAGTTGCATGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-2058s1c1
Sequence:CCGGGCAGATAGAGAATCTCAGCTTCTCGAGAAGCTGAGATTCTCTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032206.2-5246s1c1
Sequence:CCGGCCTGTAAGATTGACAACCAGACTCGAGTCTGGTTGTCAATCTTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032206.2-4703s1c1
Sequence:CCGGCCTTGCTTACTCACAGACTAACTCGAGTTAGTCTGTGAGTAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426486    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-5882s21c1
Sequence:CCGGTTTCGCCCACTGGGATAATTGCTCGAGCAATTATCCCAGTGGGCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032206.3-6213s21c1
Sequence:CCGGACATGATTGTTGGTCTATATACTCGAGTATATAGACCAACAATCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032206.3-4802s21c1
Sequence:CCGGAGCTGGACTTGTCTAACAATCCTCGAGGATTGTTAGACAAGTCCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks