EMAIL THIS PAGE TO A FRIEND

NLRP12

NLR family, pyrin domain containing 12

Synonyms: CLR19.3 FCAS2 NALP12 PAN6 PYPAF7 RNO RNO2
UniProtKB ID: P59046, Q8NEU4, Q9BY26
Gene ID:
Human(91662) Summary: This gene encodes a member of the CATERPILLER family of cytoplasmic proteins. The encoded protein, which contains an N-terminal pyrin domain, a NACHT domain, a NACHT-associated domain, and a C-terminus leucine-rich repeat region, functions as an attenuating factor of inflammation by suppressing inflammatory responses in activated monocytes. Mutations in this gene cause familial cold autoinflammatory syndrome type 2. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
Mouse(378425) NLR family, pyrin domain containing 12
Rat(292541) NLR family, pyrin domain containing 12
cow(522018) NLR family, pyrin domain containing 12
Horse(100063024) NLR family, pyrin domain containing 12
domestic cat(101085164) NLR family, pyrin domain containing 12
dog(100683399) NLR family, pyrin domain containing 12
Domestic Rabbit(100352122) NLR family, pyrin domain containing 12
naked mole-rat(101724058) NLR family, pyrin domain containing 12
sheep(101117610) NLR family, pyrin domain containing 12
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033431 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033431 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033431 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_001476888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001476888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001476888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144687 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033297 Rosetta Predictions human pricing
NM_144687 Rosetta Predictions human pricing
XM_001066862 Rosetta Predictions rat pricing
XM_218181 Rosetta Predictions rat pricing
XM_001476888 Rosetta Predictions mouse pricing
XM_904112 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217580 predicted 1599
2 SASI_Hs01_00217585 predicted 1624
3 SASI_Hs02_00361108 predicted 1609
4 SASI_Hs02_00361109 predicted 1657
5 SASI_Hs02_00361110 predicted 1641
6 SASI_Hs02_00361111 predicted 1675
7 SASI_Hs02_00361112 predicted 1628
8 SASI_Hs02_00361113 predicted 1670
9 SASI_Hs02_00361114 predicted 1631
10 SASI_Hs02_00361115 predicted 1630
11 SASI_Hs01_00217576 predicted 2122
12 SASI_Hs01_00217577 predicted 1782
13 SASI_Hs01_00217578 predicted 1511
14 SASI_Hs01_00217579 predicted 1916
15 SASI_Hs01_00217581 predicted 2177
16 SASI_Hs01_00217582 predicted 1938
17 SASI_Hs01_00217583 predicted 2080
18 SASI_Hs01_00217584 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364594 predicted 2653
2 SASI_Hs02_00364595 predicted 2685
3 SASI_Hs02_00364596 predicted 2671
4 SASI_Hs02_00364597 predicted 2725
5 SASI_Hs02_00364598 predicted 2705
6 SASI_Hs02_00364599 predicted 2735
7 SASI_Hs02_00364600 predicted 2688
8 SASI_Hs02_00364601 predicted 2740
9 SASI_Hs02_00364602 predicted 2685
10 SASI_Hs02_00364603 predicted 2693
11 SASI_Hs01_00020850 predicted 3305
12 SASI_Hs01_00020851 predicted 2537
13 SASI_Hs01_00020852 predicted 570
14 SASI_Hs01_00020853 predicted 2317
15 SASI_Hs01_00020854 predicted 1682
16 SASI_Hs01_00020855 predicted 578
17 SASI_Hs01_00020856 predicted 1803
18 SASI_Hs01_00020857 predicted 1286
19 SASI_Hs01_00020858 predicted 3132
20 SASI_Hs01_00020859 predicted 3270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318939 predicted 2815
2 SASI_Rn02_00318940 predicted 1504
3 SASI_Rn02_00318941 predicted 2055
4 SASI_Rn02_00318942 predicted 2442
5 SASI_Rn02_00318943 predicted 1109
6 SASI_Rn02_00318944 predicted 1863
7 SASI_Rn02_00318945 predicted 728
8 SASI_Rn02_00318946 predicted 475
9 SASI_Rn02_00318947 predicted 2318
10 SASI_Rn02_00318948 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377527 predicted 2824
2 SASI_Rn02_00377528 predicted 1505
3 SASI_Rn02_00377529 predicted 2057
4 SASI_Rn02_00377530 predicted 2444
5 SASI_Rn02_00377531 predicted 1110
6 SASI_Rn02_00377532 predicted 1869
7 SASI_Rn02_00377533 predicted 729
8 SASI_Rn02_00377534 predicted 477
9 SASI_Rn02_00377535 predicted 2318
10 SASI_Rn02_00377536 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391986 predicted 1310
2 SASI_Mm02_00391987 predicted 1492
3 SASI_Mm02_00391988 predicted 1723
4 SASI_Mm02_00391989 predicted 1424
5 SASI_Mm02_00391990 predicted 1294
6 SASI_Mm02_00391991 predicted 1768
7 SASI_Mm02_00391992 predicted 1706
8 SASI_Mm02_00391993 predicted 2011
9 SASI_Mm02_00391994 predicted 1725
10 SASI_Mm02_00391995 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904112 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430641 predicted 2683
2 SASI_Mm02_00430642 predicted 1029
3 SASI_Mm02_00430643 predicted 986
4 SASI_Mm02_00430644 predicted 2193
5 SASI_Mm02_00430645 predicted 2698
6 SASI_Mm02_00430646 predicted 2787
7 SASI_Mm02_00430647 predicted 2091
8 SASI_Mm02_00430648 predicted 3074
9 SASI_Mm02_00430649 predicted 2561
10 SASI_Mm02_00430650 predicted 1029
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033431
NLRP12 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 12
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1346s21c1
Sequence:CCGGGACAAGCAAGCCGGGTGTTAACTCGAGTTAACACCCGGCTTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1697s21c1
Sequence:CCGGTATTCCAGAAGGGTATCAAATCTCGAGATTTGATACCCTTCTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033431.1-3751s21c1
Sequence:CCGGTAAAGACCCACAAGGTAATTTCTCGAGAAATTACCTTGTGGGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1076s21c1
Sequence:CCGGTCATTGATGGCTTCGATAAACCTCGAGGTTTATCGAAGCCATCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-672s21c1
Sequence:CCGGCACTCGGCTTCTCCTAGTAAACTCGAGTTTACTAGGAGAAGCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033431
NLRP12 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 12
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1346s21c1
Sequence:CCGGGACAAGCAAGCCGGGTGTTAACTCGAGTTAACACCCGGCTTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1697s21c1
Sequence:CCGGTATTCCAGAAGGGTATCAAATCTCGAGATTTGATACCCTTCTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033431.1-3751s21c1
Sequence:CCGGTAAAGACCCACAAGGTAATTTCTCGAGAAATTACCTTGTGGGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1076s21c1
Sequence:CCGGTCATTGATGGCTTCGATAAACCTCGAGGTTTATCGAAGCCATCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-672s21c1
Sequence:CCGGCACTCGGCTTCTCCTAGTAAACTCGAGTTTACTAGGAGAAGCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033431
NLRP12 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 12
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1346s21c1
Sequence:CCGGGACAAGCAAGCCGGGTGTTAACTCGAGTTAACACCCGGCTTGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1697s21c1
Sequence:CCGGTATTCCAGAAGGGTATCAAATCTCGAGATTTGATACCCTTCTGGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033431.1-3751s21c1
Sequence:CCGGTAAAGACCCACAAGGTAATTTCTCGAGAAATTACCTTGTGGGTCTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-1076s21c1
Sequence:CCGGTCATTGATGGCTTCGATAAACCTCGAGGTTTATCGAAGCCATCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033431.1-672s21c1
Sequence:CCGGCACTCGGCTTCTCCTAGTAAACTCGAGTTTACTAGGAGAAGCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001476888
NLRP12 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 12
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000216380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3994s1c1
Sequence:CCGGGGTATAAGGCACCTTACAAATCTCGAGATTTGTAAGGTGCCTTATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3607s1c1
Sequence:CCGGGTAGATTCCACGCAGATAATTCTCGAGAATTATCTGCGTGGAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001476888
NLRP12 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 12
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000216380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3994s1c1
Sequence:CCGGGGTATAAGGCACCTTACAAATCTCGAGATTTGTAAGGTGCCTTATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3607s1c1
Sequence:CCGGGTAGATTCCACGCAGATAATTCTCGAGAATTATCTGCGTGGAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001476888
NLRP12 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 12
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000216380    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3994s1c1
Sequence:CCGGGGTATAAGGCACCTTACAAATCTCGAGATTTGTAAGGTGCCTTATACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216414    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_001476888.1-3607s1c1
Sequence:CCGGGTAGATTCCACGCAGATAATTCTCGAGAATTATCTGCGTGGAATCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144687
NLRP12 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 12
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144687.1-3590s1c1
Sequence:CCGGCGAGGTCAGGAGTTTGAGATTCTCGAGAATCTCAAACTCCTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-2469s1c1
Sequence:CCGGGCTCTCATAGCCAATAAGAATCTCGAGATTCTTATTGGCTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1715s1c1
Sequence:CCGGCCACTTGAGTTTCCAGGAATTCTCGAGAATTCCTGGAAACTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-3179s1c1
Sequence:CCGGCGACCTTTACCTGACCAACAACTCGAGTTGTTGGTCAGGTAAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1286s1c1
Sequence:CCGGGAAGGAATACTTCTACAAGTACTCGAGTACTTGTAGAAGTATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144687
NLRP12 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 12
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144687.1-3590s1c1
Sequence:CCGGCGAGGTCAGGAGTTTGAGATTCTCGAGAATCTCAAACTCCTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-2469s1c1
Sequence:CCGGGCTCTCATAGCCAATAAGAATCTCGAGATTCTTATTGGCTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1715s1c1
Sequence:CCGGCCACTTGAGTTTCCAGGAATTCTCGAGAATTCCTGGAAACTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-3179s1c1
Sequence:CCGGCGACCTTTACCTGACCAACAACTCGAGTTGTTGGTCAGGTAAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1286s1c1
Sequence:CCGGGAAGGAATACTTCTACAAGTACTCGAGTACTTGTAGAAGTATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144687
NLRP12 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 12
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144687.1-3590s1c1
Sequence:CCGGCGAGGTCAGGAGTTTGAGATTCTCGAGAATCTCAAACTCCTGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-2469s1c1
Sequence:CCGGGCTCTCATAGCCAATAAGAATCTCGAGATTCTTATTGGCTATGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1715s1c1
Sequence:CCGGCCACTTGAGTTTCCAGGAATTCTCGAGAATTCCTGGAAACTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-3179s1c1
Sequence:CCGGCGACCTTTACCTGACCAACAACTCGAGTTGTTGGTCAGGTAAAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144687.1-1286s1c1
Sequence:CCGGGAAGGAATACTTCTACAAGTACTCGAGTACTTGTAGAAGTATTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks