EMAIL THIS PAGE TO A FRIEND

NLRP2

NLR family, pyrin domain containing 2

Synonyms: CLR19.9 NALP2 NBS1 PAN1 PYPAF2
Gene ID:
Human(55655) Summary: NALP proteins, such as NALP2, are characterized by an N-terminal pyrin (MIM 608107) domain (PYD) and are involved in the activation of caspase-1 (CASP1; MIM 147678) by Toll-like receptors (see TLR4; MIM 603030). They may also be involved in protein complexes that activate proinflammatory caspases (Tschopp et al., 2003 [PubMed 12563287]
Mouse(232827) NLR family, pyrin domain containing 2
sheep(101123321) NLR family, pyrin domain containing 2
Domestic Rabbit(100344125) NLR family, pyrin domain containing 2
dog(484304) NLR family, pyrin domain containing 2
Horse(100055187) NLR family, pyrin domain containing 2
cow(100301026) NLR family, pyrin domain containing 2
domestic cat(101093815) NLR family, pyrin domain containing 2
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017852 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086731 MISSION® esiRNA esiRNA human NLRP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017852 Rosetta Predictions human pricing
NM_177690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212151 predicted 449
2 SASI_Hs01_00212152 predicted 2336
3 SASI_Hs01_00212153 predicted 2827
4 SASI_Hs01_00212154 predicted 3147
5 SASI_Hs01_00212155 predicted 2379
6 SASI_Hs01_00212156 predicted 2888
7 SASI_Hs01_00212157 predicted 2636
8 SASI_Hs01_00212158 predicted 1827
9 SASI_Hs01_00212159 predicted 1999
10 SASI_Hs01_00212160 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065891 predicted 2454
2 SASI_Mm02_00348021 predicted 1145
3 SASI_Mm01_00065894 predicted 467
4 SASI_Mm01_00065895 predicted 2485
5 SASI_Mm01_00065896 predicted 409
6 SASI_Mm02_00348022 predicted 1084
7 SASI_Mm02_00348023 predicted 1178
8 SASI_Mm01_00065897 predicted 1008
9 SASI_Mm02_00348024 predicted 3059
10 SASI_Mm01_00065898 predicted 827
11 SASI_Mm01_00065892 predicted 1728
12 SASI_Mm01_00065893 predicted 2466
13 SASI_Mm01_00065899 predicted 1215
14 SASI_Mm01_00065900 predicted 672
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017852
VALIDATED
NLRP2 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2885s21c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2051s21c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-632s21c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-3083s21c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017852.2-3367s21c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-633s1c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3084s1c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3166s1c1
Sequence:CCGGCTCAATAAGCTGCTGGAAGAACTCGAGTTCTTCCAGCAGCTTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-2052s1c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-481s1c1
Sequence:CCGGCAAGCGTTTACAGAAACGAAACTCGAGTTTCGTTTCTGTAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-2886s1c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3285s1c1
Sequence:CCGGGAGTCATTCATTCTCCATGAACTCGAGTTCATGGAGAATGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017852.1-3163s1c1
Sequence:CCGGGAACTCAATAAGCTGCTGGAACTCGAGTTCCAGCAGCTTATTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-3368s1c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017852
VALIDATED
NLRP2 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2885s21c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2051s21c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-632s21c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-3083s21c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017852.2-3367s21c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-633s1c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3084s1c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3166s1c1
Sequence:CCGGCTCAATAAGCTGCTGGAAGAACTCGAGTTCTTCCAGCAGCTTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-2052s1c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-481s1c1
Sequence:CCGGCAAGCGTTTACAGAAACGAAACTCGAGTTTCGTTTCTGTAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-2886s1c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3285s1c1
Sequence:CCGGGAGTCATTCATTCTCCATGAACTCGAGTTCATGGAGAATGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017852.1-3163s1c1
Sequence:CCGGGAACTCAATAAGCTGCTGGAACTCGAGTTCCAGCAGCTTATTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-3368s1c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017852
VALIDATED
NLRP2 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2885s21c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-2051s21c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-632s21c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017852.2-3083s21c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017852.2-3367s21c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-633s1c1
Sequence:CCGGCCAGGTTATGGCTGAGAGATACTCGAGTATCTCTCAGCCATAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3084s1c1
Sequence:CCGGGAAGATGCTGTTTGAAACCTTCTCGAGAAGGTTTCAAACAGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3166s1c1
Sequence:CCGGCTCAATAAGCTGCTGGAAGAACTCGAGTTCTTCCAGCAGCTTATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017852.1-2052s1c1
Sequence:CCGGGCAGGTAATAAAGGAGAATCTCTCGAGAGATTCTCCTTTATTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-481s1c1
Sequence:CCGGCAAGCGTTTACAGAAACGAAACTCGAGTTTCGTTTCTGTAAACGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128236    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-2886s1c1
Sequence:CCGGGCTGAATCACATAGGAGTTAACTCGAGTTAACTCCTATGTGATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128382    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_017852.1-3285s1c1
Sequence:CCGGGAGTCATTCATTCTCCATGAACTCGAGTTCATGGAGAATGAATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017852.1-3163s1c1
Sequence:CCGGGAACTCAATAAGCTGCTGGAACTCGAGTTCCAGCAGCTTATTGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129801    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_017852.1-3368s1c1
Sequence:CCGGCTCAGGGATAATGAGTTCATTCTCGAGAATGAACTCATTATCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177690
NLRP2 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-2069s1c1
Sequence:CCGGCGGATGAACAACGCATGTTAACTCGAGTTAACATGCGTTGTTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3025s1c1
Sequence:CCGGGCCATAAAGACATTCTGTGAACTCGAGTTCACAGAATGTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-1470s1c1
Sequence:CCGGCCTAAACAATTTGCATCCCATCTCGAGATGGGATGCAAATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3164s1c1
Sequence:CCGGGCAGTGACCAAGTGGATCTTACTCGAGTAAGATCCACTTGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177690
NLRP2 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-2069s1c1
Sequence:CCGGCGGATGAACAACGCATGTTAACTCGAGTTAACATGCGTTGTTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3025s1c1
Sequence:CCGGGCCATAAAGACATTCTGTGAACTCGAGTTCACAGAATGTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-1470s1c1
Sequence:CCGGCCTAAACAATTTGCATCCCATCTCGAGATGGGATGCAAATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3164s1c1
Sequence:CCGGGCAGTGACCAAGTGGATCTTACTCGAGTAAGATCCACTTGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177690
NLRP2 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-2069s1c1
Sequence:CCGGCGGATGAACAACGCATGTTAACTCGAGTTAACATGCGTTGTTCATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3025s1c1
Sequence:CCGGGCCATAAAGACATTCTGTGAACTCGAGTTCACAGAATGTCTTTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177690.2-1470s1c1
Sequence:CCGGCCTAAACAATTTGCATCCCATCTCGAGATGGGATGCAAATTGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177690.2-3164s1c1
Sequence:CCGGGCAGTGACCAAGTGGATCTTACTCGAGTAAGATCCACTTGGTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks