EMAIL THIS PAGE TO A FRIEND

NLRP8

NLR family, pyrin domain containing 8

Synonyms: CLR19.2 NALP8 NOD16 PAN4
UniProtKB ID: Q86W28, Q7RTR4
Gene ID:
Human(126205) Summary: NALPs are cytoplasmic proteins that form a subfamily within the larger CATERPILLER protein family. Most short NALPs, such as NALP8, have an N-terminal pyrin (MEFV; MIM 608107) domain (PYD), followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. The long NALP, NALP1 (MIM 606636), also has a C-terminal extension containing a function to find domain (FIIND) and a caspase recruitment domain (CARD). NALPs are implicated in the activation of proinflammatory caspases (e.g., CASP1; MIM 147678) via their involvement in multiprotein complexes called inflammasomes (Tschopp et al., 2003 [PubMed 12563287]
cow(506161) NLR family, pyrin domain containing 8
domestic cat(101081425) NLR family, pyrin domain containing 8
dog(611217) NLR family, pyrin domain containing 8
naked mole-rat(101718784) NLR family, pyrin domain containing 8
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176811 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176811 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176811 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176811 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176811 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186498 predicted 1659
2 SASI_Hs01_00186499 predicted 1058
3 SASI_Hs01_00186500 predicted 2134
4 SASI_Hs01_00186501 predicted 1983
5 SASI_Hs01_00186502 predicted 2912
6 SASI_Hs01_00186503 predicted 1349
7 SASI_Hs01_00186504 predicted 361
8 SASI_Hs01_00186506 predicted 230
9 SASI_Hs01_00186507 predicted 1339
10 SASI_Hs02_00369225 predicted 2614
11 SASI_Hs01_00186505 predicted 2500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176811
NLRP8 MISSION shRNA Bacterial Glycerol Stock
NLR family, pyrin domain containing 8
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3346s1c1
Sequence:CCGGCCACAGAACCTCAGCTTTGAACTCGAGTTCAAAGCTGAGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3605s1c1
Sequence:CCGGCAGGAGAATCACTTGAATCTACTCGAGTAGATTCAAGTGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1802s1c1
Sequence:CCGGCAAGGTGTCTTTCGGTAATAACTCGAGTTATTACCGAAAGACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1538s1c1
Sequence:CCGGCATGAGTATTCTTCGGAGAATCTCGAGATTCTCCGAAGAATACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-2474s1c1
Sequence:CCGGCCCTAGAATTTGGACTGATCTCTCGAGAGATCAGTCCAAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176811.2-2507s21c1
Sequence:CCGGTCAAGGTAACGGGCATCTAAACTCGAGTTTAGATGCCCGTTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176811
NLRP8 MISSION shRNA shRNA Plasmid DNA
NLR family, pyrin domain containing 8
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3346s1c1
Sequence:CCGGCCACAGAACCTCAGCTTTGAACTCGAGTTCAAAGCTGAGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3605s1c1
Sequence:CCGGCAGGAGAATCACTTGAATCTACTCGAGTAGATTCAAGTGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1802s1c1
Sequence:CCGGCAAGGTGTCTTTCGGTAATAACTCGAGTTATTACCGAAAGACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1538s1c1
Sequence:CCGGCATGAGTATTCTTCGGAGAATCTCGAGATTCTCCGAAGAATACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-2474s1c1
Sequence:CCGGCCCTAGAATTTGGACTGATCTCTCGAGAGATCAGTCCAAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176811.2-2507s21c1
Sequence:CCGGTCAAGGTAACGGGCATCTAAACTCGAGTTTAGATGCCCGTTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176811
NLRP8 MISSION shRNA Lentiviral Transduction Particles
NLR family, pyrin domain containing 8
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3346s1c1
Sequence:CCGGCCACAGAACCTCAGCTTTGAACTCGAGTTCAAAGCTGAGGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176811.2-3605s1c1
Sequence:CCGGCAGGAGAATCACTTGAATCTACTCGAGTAGATTCAAGTGATTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1802s1c1
Sequence:CCGGCAAGGTGTCTTTCGGTAATAACTCGAGTTATTACCGAAAGACACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-1538s1c1
Sequence:CCGGCATGAGTATTCTTCGGAGAATCTCGAGATTCTCCGAAGAATACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176811.2-2474s1c1
Sequence:CCGGCCCTAGAATTTGGACTGATCTCTCGAGAGATCAGTCCAAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176811.2-2507s21c1
Sequence:CCGGTCAAGGTAACGGGCATCTAAACTCGAGTTTAGATGCCCGTTACCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks