EMAIL THIS PAGE TO A FRIEND

NME7

NME/NM23 family member 7

Synonyms: MN23H7 nm23-H7
UniProtKB ID: Q9Y5B8, A8K3T6, A8MY09, B3KSW9, Q5TGZ4
Gene ID:
Mouse(171567) NME/NM23 family member 7
Rat(171566) NME/NM23 family member 7
Zebrafish(30086) non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
dog(100686107) NME/NM23 family member 7
domestic cat(101082117) NME/NM23 family member 7
cow(534611) non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)
chicken(100858145) NME/NM23 family member 7
domestic guinea pig(100715313) NME/NM23 family member 7
naked mole-rat(101717407) NME/NM23 family member 7
sheep(101122612) NME/NM23 family member 7
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013330 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013330 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013330 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138314 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138314 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138314 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013330 Rosetta Predictions human pricing
NM_197972 Rosetta Predictions human pricing
NM_138532 Rosetta Predictions rat pricing
NM_138314 Rosetta Predictions mouse pricing
NM_178071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013330 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244234 predicted 926
2 SASI_Hs02_00344634 predicted 1176
3 SASI_Hs01_00244235 predicted 1322
4 SASI_Hs01_00244236 predicted 1074
5 SASI_Hs01_00244237 predicted 873
6 SASI_Hs01_00244238 predicted 1287
7 SASI_Hs01_00244239 predicted 1158
8 SASI_Hs01_00244240 predicted 1232
9 SASI_Hs01_00244241 predicted 1052
10 SASI_Hs01_00244242 predicted 820
11 SASI_Hs01_00244243 predicted 1170
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192304 predicted 892
2 SASI_Hs02_00371585 predicted 1146
3 SASI_Hs01_00192305 predicted 1295
4 SASI_Hs01_00192306 predicted 1048
5 SASI_Hs01_00192307 predicted 849
6 SASI_Hs01_00192308 predicted 1259
7 SASI_Hs01_00192309 predicted 1129
8 SASI_Hs01_00192310 predicted 1206
9 SASI_Hs01_00192311 predicted 1023
10 SASI_Hs01_00192312 predicted 790
11 SASI_Hs01_00192313 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034574 predicted 366
2 SASI_Rn01_00034575 predicted 599
3 SASI_Rn01_00034576 predicted 664
4 SASI_Rn01_00034577 predicted 964
5 SASI_Rn01_00034578 predicted 283
6 SASI_Rn01_00034579 predicted 237
7 SASI_Rn01_00034580 predicted 450
8 SASI_Rn01_00034581 predicted 292
9 SASI_Rn01_00034582 predicted 649
10 SASI_Rn01_00034583 predicted 1225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138314 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122703 predicted 650
2 SASI_Mm01_00122704 predicted 643
3 SASI_Mm02_00339614 predicted 696
4 SASI_Mm01_00122705 predicted 577
5 SASI_Mm01_00122706 predicted 664
6 SASI_Mm01_00122707 predicted 653
7 SASI_Mm01_00122708 predicted 595
8 SASI_Mm01_00122709 predicted 553
9 SASI_Mm01_00122711 predicted 627
10 SASI_Mm01_00122712 predicted 548
11 SASI_Mm01_00122710 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161950 predicted 695
2 SASI_Mm01_00161951 predicted 682
3 SASI_Mm02_00348529 predicted 741
4 SASI_Mm01_00161952 predicted 617
5 SASI_Mm01_00161953 predicted 709
6 SASI_Mm01_00161954 predicted 693
7 SASI_Mm01_00161955 predicted 642
8 SASI_Mm01_00161956 predicted 602
9 SASI_Mm01_00161958 predicted 663
10 SASI_Mm01_00161959 predicted 594
11 SASI_Mm01_00161957 predicted 772
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013330
VALIDATED
NME7 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 family member 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010221    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-144s1c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-591s1c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-921s1c1
Sequence:CCGGGATCGGGTTAATGTTGAGGAACTCGAGTTCCTCAACATTAACCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-658s1c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-329s1c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-804s21c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-737s21c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-290s21c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000342536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-475s21c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013330
VALIDATED
NME7 MISSION shRNA shRNA Plasmid DNA
NME/NM23 family member 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010221    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-144s1c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-591s1c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-921s1c1
Sequence:CCGGGATCGGGTTAATGTTGAGGAACTCGAGTTCCTCAACATTAACCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-658s1c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-329s1c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-804s21c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-737s21c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-290s21c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000342536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-475s21c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013330
VALIDATED
NME7 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 family member 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010221    
Product Details
Validated
Region:5UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-144s1c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_013330.x-591s1c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-921s1c1
Sequence:CCGGGATCGGGTTAATGTTGAGGAACTCGAGTTCCTCAACATTAACCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-658s1c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013330.x-329s1c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-804s21c1
Sequence:CCGGCTGAAAGCATTAGAGCCCTCTCTCGAGAGAGGGCTCTAATGCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-737s21c1
Sequence:CCGGGATGCTATATGTGAATGGAAACTCGAGTTTCCATTCACATATAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-290s21c1
Sequence:CCGGGCTTCACTTCTTCGACGTTATCTCGAGATAACGTCGAAGAAGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000342536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013330.3-475s21c1
Sequence:CCGGGGATCAATATACAGCTCGCCACTCGAGTGGCGAGCTGTATATTGATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138314
VALIDATED
NME7 MISSION shRNA Bacterial Glycerol Stock
NME/NM23 family member 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-901s1c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138314.1-1445s1c1
Sequence:CCGGGTGAGGAATGTGTTCATTCTTCTCGAGAAGAATGAACACATTCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-424s1c1
Sequence:CCGGCGCCTGGAAGATCTATTTATACTCGAGTATAAATAGATCTTCCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-945s1c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1222s21c1
Sequence:CCGGGGTGTAGTGTCTGAGTATAATCTCGAGATTATACTCAGACACTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1041s21c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138314.3-997s21c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-518s21c1
Sequence:CCGGTGCGCCTGGAAGATCTATTTACTCGAGTAAATAGATCTTCCAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-328s21c1
Sequence:CCGGAGTTTGGTTTCTCCATATATGCTCGAGCATATATGGAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138314
VALIDATED
NME7 MISSION shRNA shRNA Plasmid DNA
NME/NM23 family member 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-901s1c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138314.1-1445s1c1
Sequence:CCGGGTGAGGAATGTGTTCATTCTTCTCGAGAAGAATGAACACATTCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-424s1c1
Sequence:CCGGCGCCTGGAAGATCTATTTATACTCGAGTATAAATAGATCTTCCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-945s1c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1222s21c1
Sequence:CCGGGGTGTAGTGTCTGAGTATAATCTCGAGATTATACTCAGACACTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1041s21c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138314.3-997s21c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-518s21c1
Sequence:CCGGTGCGCCTGGAAGATCTATTTACTCGAGTAAATAGATCTTCCAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-328s21c1
Sequence:CCGGAGTTTGGTTTCTCCATATATGCTCGAGCATATATGGAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138314
VALIDATED
NME7 MISSION shRNA Lentiviral Transduction Particles
NME/NM23 family member 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-901s1c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_138314.1-1445s1c1
Sequence:CCGGGTGAGGAATGTGTTCATTCTTCTCGAGAAGAATGAACACATTCCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-424s1c1
Sequence:CCGGCGCCTGGAAGATCTATTTATACTCGAGTATAAATAGATCTTCCAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138314.1-945s1c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1222s21c1
Sequence:CCGGGGTGTAGTGTCTGAGTATAATCTCGAGATTATACTCAGACACTACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-1041s21c1
Sequence:CCGGGCCAGCGAACACTGCTAAATTCTCGAGAATTTAGCAGTGTTCGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138314.3-997s21c1
Sequence:CCGGGCCAGAGAAATGGAATTGTTTCTCGAGAAACAATTCCATTTCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-518s21c1
Sequence:CCGGTGCGCCTGGAAGATCTATTTACTCGAGTAAATAGATCTTCCAGGCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_138314.3-328s21c1
Sequence:CCGGAGTTTGGTTTCTCCATATATGCTCGAGCATATATGGAGAAACCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks