EMAIL THIS PAGE TO A FRIEND

NMNAT3

nicotinamide nucleotide adenylyltransferase 3

Synonyms: PNAT-3 PNAT3
UniProtKB ID: Q96T66, B3KVR6, D3DNF2, D3DNF3, Q8N4G1
Gene ID:
Human(349565) Summary: This gene encodes a member of the nicotinamide/nicotinic acid mononucleotide adenylyltransferase family. These enzymes use ATP to catalyze the synthesis of nicotinamide adenine dinucleotide or nicotinic acid adenine dinucleotide from nicotinamide mononucleotide or nicotinic acid mononucleotide, respectively. The encoded protein is localized to mitochondria and may also play a neuroprotective role as a molecular chaperone. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Mouse(74080) nicotinamide nucleotide adenylyltransferase 3
Rat(363118) nicotinamide nucleotide adenylyltransferase 3
Zebrafish(572070) novel protein similar to vertebrate nicotinamide nucleotide adenylyltransferase protein family
cow(100337285) nicotinamide nucleotide adenylyltransferase 3
domestic cat(101099322) nicotinamide nucleotide adenylyltransferase 3
dog(477091) nicotinamide nucleotide adenylyltransferase 3
chicken(424820) nicotinamide nucleotide adenylyltransferase 3
domestic guinea pig(100729944) nicotinamide nucleotide adenylyltransferase 3
naked mole-rat(101719982) nicotinamide nucleotide adenylyltransferase 3
sheep(101109937) nicotinamide nucleotide adenylyltransferase 3
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178177 Rosetta Predictions human pricing
NM_001013224 Rosetta Predictions rat pricing
NM_144533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068505 predicted 1221
2 SASI_Hs01_00068508 predicted 1164
3 SASI_Hs01_00068509 predicted 1275
4 SASI_Hs01_00068510 predicted 739
5 SASI_Hs01_00068511 predicted 874
6 SASI_Hs01_00068512 predicted 1451
7 SASI_Hs02_00369592 predicted 942
8 SASI_Hs02_00369593 predicted 1159
9 SASI_Hs01_00068514 predicted 1394
10 SASI_Hs02_00369594 predicted 927
11 SASI_Hs01_00068506 predicted 1458
12 SASI_Hs01_00068507 predicted 568
13 SASI_Hs01_00068513 predicted 1097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013224 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063083 predicted 921
2 SASI_Rn01_00063084 predicted 275
3 SASI_Rn01_00063085 predicted 409
4 SASI_Rn01_00063086 predicted 934
5 SASI_Rn01_00063087 predicted 541
6 SASI_Rn01_00063089 predicted 537
7 SASI_Rn01_00063090 predicted 200
8 SASI_Rn01_00063091 predicted 276
9 SASI_Rn01_00063092 predicted 721
10 SASI_Rn02_00201027 predicted 899
11 SASI_Rn01_00063088 predicted 600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194519 predicted 971
2 SASI_Mm01_00194520 predicted 443
3 SASI_Mm01_00194521 predicted 930
4 SASI_Mm01_00194523 predicted 695
5 SASI_Mm01_00194524 predicted 519
6 SASI_Mm01_00194525 predicted 438
7 SASI_Mm01_00194526 predicted 576
8 SASI_Mm01_00194527 predicted 527
9 SASI_Mm01_00194528 predicted 481
10 SASI_Mm02_00340065 predicted 875
11 SASI_Mm01_00194522 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178177
NMNAT3 MISSION shRNA Bacterial Glycerol Stock
nicotinamide nucleotide adenylyltransferase 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-921s1c1
Sequence:CCGGGCAGAGCGTAAAGTACCTGATCTCGAGATCAGGTACTTTACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-745s1c1
Sequence:CCGGCAGGAAATAGTGGAGAAGTTTCTCGAGAAACTTCTCCACTATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-424s1c1
Sequence:CCGGTCTCCTGTCAACGACACCTATCTCGAGATAGGTGTCGTTGACAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-876s1c1
Sequence:CCGGGAATGAGATCAGTGCCACATACTCGAGTATGTGGCACTGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-945s1c1
Sequence:CCGGCGATGCTGTCATCACGTACATCTCGAGATGTACGTGATGACAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1316s21c1
Sequence:CCGGGACAAGGAGGTCTACTTATTTCTCGAGAAATAAGTAGACCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178177.2-447s21c1
Sequence:CCGGGAAGAAAGACCTCGCAGCTTCCTCGAGGAAGCTGCGAGGTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1473s21c1
Sequence:CCGGGATTTGACAGGATGCTAATTACTCGAGTAATTAGCATCCTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178177
NMNAT3 MISSION shRNA shRNA Plasmid DNA
nicotinamide nucleotide adenylyltransferase 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-921s1c1
Sequence:CCGGGCAGAGCGTAAAGTACCTGATCTCGAGATCAGGTACTTTACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-745s1c1
Sequence:CCGGCAGGAAATAGTGGAGAAGTTTCTCGAGAAACTTCTCCACTATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-424s1c1
Sequence:CCGGTCTCCTGTCAACGACACCTATCTCGAGATAGGTGTCGTTGACAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-876s1c1
Sequence:CCGGGAATGAGATCAGTGCCACATACTCGAGTATGTGGCACTGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-945s1c1
Sequence:CCGGCGATGCTGTCATCACGTACATCTCGAGATGTACGTGATGACAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1316s21c1
Sequence:CCGGGACAAGGAGGTCTACTTATTTCTCGAGAAATAAGTAGACCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178177.2-447s21c1
Sequence:CCGGGAAGAAAGACCTCGCAGCTTCCTCGAGGAAGCTGCGAGGTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1473s21c1
Sequence:CCGGGATTTGACAGGATGCTAATTACTCGAGTAATTAGCATCCTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178177
NMNAT3 MISSION shRNA Lentiviral Transduction Particles
nicotinamide nucleotide adenylyltransferase 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-921s1c1
Sequence:CCGGGCAGAGCGTAAAGTACCTGATCTCGAGATCAGGTACTTTACGCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-745s1c1
Sequence:CCGGCAGGAAATAGTGGAGAAGTTTCTCGAGAAACTTCTCCACTATTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-424s1c1
Sequence:CCGGTCTCCTGTCAACGACACCTATCTCGAGATAGGTGTCGTTGACAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-876s1c1
Sequence:CCGGGAATGAGATCAGTGCCACATACTCGAGTATGTGGCACTGATCTCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178177.2-945s1c1
Sequence:CCGGCGATGCTGTCATCACGTACATCTCGAGATGTACGTGATGACAGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1316s21c1
Sequence:CCGGGACAAGGAGGTCTACTTATTTCTCGAGAAATAAGTAGACCTCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178177.2-447s21c1
Sequence:CCGGGAAGAAAGACCTCGCAGCTTCCTCGAGGAAGCTGCGAGGTCTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428929    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178177.2-1473s21c1
Sequence:CCGGGATTTGACAGGATGCTAATTACTCGAGTAATTAGCATCCTGTCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144533
VALIDATED
NMNAT3 MISSION shRNA Bacterial Glycerol Stock
nicotinamide nucleotide adenylyltransferase 3
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144533.1-1565s1c1
Sequence:CCGGCGGCTCAAACAATAATAGCAACTCGAGTTGCTATTATTGTTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-870s1c1
Sequence:CCGGCCTCTGGAAAGACACGCACATCTCGAGATGTGCGTGTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-1033s1c1
Sequence:CCGGAGTGCCACATACGTCAGGAAACTCGAGTTTCCTGACGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-579s1c1
Sequence:CCGGCGTCAATGACAGCTATGGGAACTCGAGTTCCCATAGCTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-979s1c1
Sequence:CCGGCAGCAGTTTCAGCACAACATTCTCGAGAATGTTGTGCTGAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144533.2-1294s21c1
Sequence:CCGGTCGAGTATCAGAGCAACTTAACTCGAGTTAAGTTGCTCTGATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-494s21c1
Sequence:CCGGATATGCACCTGCGCTTGTTTGCTCGAGCAAACAAGCGCAGGTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144533.2-566s21c1
Sequence:CCGGGCATCATCTCACCCGTCAATGCTCGAGCATTGACGGGTGAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-941s21c1
Sequence:CCGGATGACCCGGAAAGGTACATCTCTCGAGAGATGTACCTTTCCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1517s21c1
Sequence:CCGGAGTTTGACAGGGCGCTAATTACTCGAGTAATTAGCGCCCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-806s21c1
Sequence:CCGGCAGCACTGCCAGAGTTGAAACCTCGAGGTTTCAACTCTGGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1094s21c1
Sequence:CCGGAGGCCGTCATCACCTACATCACTCGAGTGATGTAGGTGATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144533
VALIDATED
NMNAT3 MISSION shRNA shRNA Plasmid DNA
nicotinamide nucleotide adenylyltransferase 3
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144533.1-1565s1c1
Sequence:CCGGCGGCTCAAACAATAATAGCAACTCGAGTTGCTATTATTGTTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-870s1c1
Sequence:CCGGCCTCTGGAAAGACACGCACATCTCGAGATGTGCGTGTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-1033s1c1
Sequence:CCGGAGTGCCACATACGTCAGGAAACTCGAGTTTCCTGACGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-579s1c1
Sequence:CCGGCGTCAATGACAGCTATGGGAACTCGAGTTCCCATAGCTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-979s1c1
Sequence:CCGGCAGCAGTTTCAGCACAACATTCTCGAGAATGTTGTGCTGAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144533.2-1294s21c1
Sequence:CCGGTCGAGTATCAGAGCAACTTAACTCGAGTTAAGTTGCTCTGATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-494s21c1
Sequence:CCGGATATGCACCTGCGCTTGTTTGCTCGAGCAAACAAGCGCAGGTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144533.2-566s21c1
Sequence:CCGGGCATCATCTCACCCGTCAATGCTCGAGCATTGACGGGTGAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-941s21c1
Sequence:CCGGATGACCCGGAAAGGTACATCTCTCGAGAGATGTACCTTTCCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1517s21c1
Sequence:CCGGAGTTTGACAGGGCGCTAATTACTCGAGTAATTAGCGCCCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-806s21c1
Sequence:CCGGCAGCACTGCCAGAGTTGAAACCTCGAGGTTTCAACTCTGGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1094s21c1
Sequence:CCGGAGGCCGTCATCACCTACATCACTCGAGTGATGTAGGTGATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144533
VALIDATED
NMNAT3 MISSION shRNA Lentiviral Transduction Particles
nicotinamide nucleotide adenylyltransferase 3
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144533.1-1565s1c1
Sequence:CCGGCGGCTCAAACAATAATAGCAACTCGAGTTGCTATTATTGTTTGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-870s1c1
Sequence:CCGGCCTCTGGAAAGACACGCACATCTCGAGATGTGCGTGTCTTTCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-1033s1c1
Sequence:CCGGAGTGCCACATACGTCAGGAAACTCGAGTTTCCTGACGTATGTGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-579s1c1
Sequence:CCGGCGTCAATGACAGCTATGGGAACTCGAGTTCCCATAGCTGTCATTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144533.1-979s1c1
Sequence:CCGGCAGCAGTTTCAGCACAACATTCTCGAGAATGTTGTGCTGAAACTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366159    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144533.2-1294s21c1
Sequence:CCGGTCGAGTATCAGAGCAACTTAACTCGAGTTAAGTTGCTCTGATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-494s21c1
Sequence:CCGGATATGCACCTGCGCTTGTTTGCTCGAGCAAACAAGCGCAGGTGCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144533.2-566s21c1
Sequence:CCGGGCATCATCTCACCCGTCAATGCTCGAGCATTGACGGGTGAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-941s21c1
Sequence:CCGGATGACCCGGAAAGGTACATCTCTCGAGAGATGTACCTTTCCGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1517s21c1
Sequence:CCGGAGTTTGACAGGGCGCTAATTACTCGAGTAATTAGCGCCCTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-806s21c1
Sequence:CCGGCAGCACTGCCAGAGTTGAAACCTCGAGGTTTCAACTCTGGCAGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144533.2-1094s21c1
Sequence:CCGGAGGCCGTCATCACCTACATCACTCGAGTGATGTAGGTGATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks