EMAIL THIS PAGE TO A FRIEND

NOD2

nucleotide-binding oligomerization domain containing 2

Synonyms: ACUG BLAU CARD15 CD CLR16.3 IBD1 NLRC2 NOD2B PSORAS1
UniProtKB ID: Q9HC29, E2JEQ6, Q96RH5, Q96RH6, Q96RH8
Gene ID:
Human(64127) Summary: This gene is a member of the Nod1/Apaf-1 family and encodes a protein with two caspase recruitment (CARD) domains and six leucine-rich repeats (LRRs). The protein is primarily expressed in the peripheral blood leukocytes. It plays a role in the immune response to intracellular bacterial lipopolysaccharides (LPS) by recognizing the muramyl dipeptide (MDP) derived from them and activating the NFKB protein. Mutations in this gene have been associated with Crohn disease and Blau syndrome. [provided by RefSeq, Jul 2008]
Mouse(257632) nucleotide-binding oligomerization domain containing 2
Rat(291912) nucleotide-binding oligomerization domain containing 2
domestic guinea pig(100727812) nucleotide-binding oligomerization domain containing 2
Domestic Rabbit(100356594) nucleotide-binding oligomerization domain containing 2
naked mole-rat(101709371) nucleotide-binding oligomerization domain containing 2
sheep(780465) nucleotide-binding oligomerization domain containing 2
Zebrafish(777696) nucleotide-binding oligomerization domain containing 2
cow(444867) nucleotide-binding oligomerization domain containing 2
domestic cat(101096863) nucleotide-binding oligomerization domain containing 2
dog(487286) nucleotide-binding oligomerization domain containing 2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022162 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022162 Rosetta Predictions human pricing
NM_001106172 Rosetta Predictions rat pricing
NM_145857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355593 predicted 2562
2 SASI_Hs01_00218853 predicted 1229
3 SASI_Hs01_00218854 predicted 2648
4 SASI_Hs01_00218855 predicted 588
5 SASI_Hs02_00355594 predicted 2647
6 SASI_Hs01_00218857 predicted 1578
7 SASI_Hs01_00218858 predicted 2387
8 SASI_Hs01_00218859 predicted 1894
9 SASI_Hs01_00218860 predicted 1622
10 SASI_Hs01_00218861 predicted 2636
11 SASI_Hs01_00218852 predicted 2953
12 SASI_Hs01_00218856 predicted 3248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106172 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216338 predicted 576
2 SASI_Rn02_00216339 predicted 426
3 SASI_Rn02_00216340 predicted 1042
4 SASI_Rn02_00216341 predicted 1457
5 SASI_Rn02_00216342 predicted 1734
6 SASI_Rn02_00216343 predicted 2831
7 SASI_Rn02_00216344 predicted 497
8 SASI_Rn02_00216345 predicted 2391
9 SASI_Rn02_00216346 predicted 1171
10 SASI_Rn02_00216347 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090569 predicted 329
2 SASI_Mm01_00090570 predicted 2447
3 SASI_Mm01_00090571 predicted 1111
4 SASI_Mm01_00090572 predicted 3016
5 SASI_Mm01_00090573 predicted 1112
6 SASI_Mm01_00090574 predicted 2329
7 SASI_Mm01_00090575 predicted 1291
8 SASI_Mm01_00090576 predicted 2591
9 SASI_Mm02_00341360 predicted 987
10 SASI_Mm01_00090577 predicted 403
11 SASI_Mm01_00090578 predicted 1723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022162
NOD2 MISSION shRNA Bacterial Glycerol Stock
nucleotide-binding oligomerization domain containing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-659s21c1
Sequence:CCGGTTGATCTTGCCACGGTGAAAGCTCGAGCTTTCACCGTGGCAAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022162.1-3363s21c1
Sequence:CCGGGAACACCATAGGTCACCTTTACTCGAGTAAAGGTGACCTATGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-594s21c1
Sequence:CCGGCCAGTATGAATGTGATGAAATCTCGAGATTTCATCACATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-377s1c1
Sequence:CCGGCCGTCTGGAATAAGGGTACTTCTCGAGAAGTACCCTTATTCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-593s1c1
Sequence:CCGGGCCAGTATGAATGTGATGAAACTCGAGTTTCATCACATTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-2959s1c1
Sequence:CCGGGCAAAGAACGTCATGCTAGAACTCGAGTTCTAGCATGACGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-850s1c1
Sequence:CCGGGAGGACATATACACAGAGAATCTCGAGATTCTCTGTGTATATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-1623s1c1
Sequence:CCGGCCCAAAGACCACTACAGATATCTCGAGATATCTGTAGTGGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022162
NOD2 MISSION shRNA shRNA Plasmid DNA
nucleotide-binding oligomerization domain containing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-659s21c1
Sequence:CCGGTTGATCTTGCCACGGTGAAAGCTCGAGCTTTCACCGTGGCAAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022162.1-3363s21c1
Sequence:CCGGGAACACCATAGGTCACCTTTACTCGAGTAAAGGTGACCTATGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-594s21c1
Sequence:CCGGCCAGTATGAATGTGATGAAATCTCGAGATTTCATCACATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-377s1c1
Sequence:CCGGCCGTCTGGAATAAGGGTACTTCTCGAGAAGTACCCTTATTCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-593s1c1
Sequence:CCGGGCCAGTATGAATGTGATGAAACTCGAGTTTCATCACATTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-2959s1c1
Sequence:CCGGGCAAAGAACGTCATGCTAGAACTCGAGTTCTAGCATGACGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-850s1c1
Sequence:CCGGGAGGACATATACACAGAGAATCTCGAGATTCTCTGTGTATATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-1623s1c1
Sequence:CCGGCCCAAAGACCACTACAGATATCTCGAGATATCTGTAGTGGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022162
NOD2 MISSION shRNA Lentiviral Transduction Particles
nucleotide-binding oligomerization domain containing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-659s21c1
Sequence:CCGGTTGATCTTGCCACGGTGAAAGCTCGAGCTTTCACCGTGGCAAGATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022162.1-3363s21c1
Sequence:CCGGGAACACCATAGGTCACCTTTACTCGAGTAAAGGTGACCTATGGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022162.1-594s21c1
Sequence:CCGGCCAGTATGAATGTGATGAAATCTCGAGATTTCATCACATTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-377s1c1
Sequence:CCGGCCGTCTGGAATAAGGGTACTTCTCGAGAAGTACCCTTATTCCAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-593s1c1
Sequence:CCGGGCCAGTATGAATGTGATGAAACTCGAGTTTCATCACATTCATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-2959s1c1
Sequence:CCGGGCAAAGAACGTCATGCTAGAACTCGAGTTCTAGCATGACGTTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-850s1c1
Sequence:CCGGGAGGACATATACACAGAGAATCTCGAGATTCTCTGTGTATATGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022162.1-1623s1c1
Sequence:CCGGCCCAAAGACCACTACAGATATCTCGAGATATCTGTAGTGGTCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145857
NOD2 MISSION shRNA Bacterial Glycerol Stock
nucleotide-binding oligomerization domain containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-724s21c1
Sequence:CCGGATCTTTGCCTGGAGGATATATCTCGAGATATATCCTCCAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2925s21c1
Sequence:CCGGCTCAAGAGAAATTCAACTTTGCTCGAGCAAAGTTGAATTTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2283s21c1
Sequence:CCGGGGGCACCTGAAGTTGACATTTCTCGAGAAATGTCAACTTCAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2444s21c1
Sequence:CCGGAGCTCTGTATTTGCGAGATAACTCGAGTTATCTCGCAAATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1752s1c1
Sequence:CCGGGCTCAGGTTGACTCTGATGATCTCGAGATCATCAGAGTCAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2633s1c1
Sequence:CCGGCCTTGCACACAAGCAGAACTTCTCGAGAAGTTCTGCTTGTGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-369s1c1
Sequence:CCGGGCCAACAGTCATACCTTTGAACTCGAGTTCAAAGGTATGACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2886s1c1
Sequence:CCGGCTGGAGAAGAACAAGTCACTACTCGAGTAGTGACTTGTTCTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1841s1c1
Sequence:CCGGGCACATTACCTTCCAGTGCTTCTCGAGAAGCACTGGAAGGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145857
NOD2 MISSION shRNA shRNA Plasmid DNA
nucleotide-binding oligomerization domain containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-724s21c1
Sequence:CCGGATCTTTGCCTGGAGGATATATCTCGAGATATATCCTCCAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2925s21c1
Sequence:CCGGCTCAAGAGAAATTCAACTTTGCTCGAGCAAAGTTGAATTTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2283s21c1
Sequence:CCGGGGGCACCTGAAGTTGACATTTCTCGAGAAATGTCAACTTCAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2444s21c1
Sequence:CCGGAGCTCTGTATTTGCGAGATAACTCGAGTTATCTCGCAAATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1752s1c1
Sequence:CCGGGCTCAGGTTGACTCTGATGATCTCGAGATCATCAGAGTCAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2633s1c1
Sequence:CCGGCCTTGCACACAAGCAGAACTTCTCGAGAAGTTCTGCTTGTGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-369s1c1
Sequence:CCGGGCCAACAGTCATACCTTTGAACTCGAGTTCAAAGGTATGACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2886s1c1
Sequence:CCGGCTGGAGAAGAACAAGTCACTACTCGAGTAGTGACTTGTTCTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1841s1c1
Sequence:CCGGGCACATTACCTTCCAGTGCTTCTCGAGAAGCACTGGAAGGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145857
NOD2 MISSION shRNA Lentiviral Transduction Particles
nucleotide-binding oligomerization domain containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-724s21c1
Sequence:CCGGATCTTTGCCTGGAGGATATATCTCGAGATATATCCTCCAGGCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2925s21c1
Sequence:CCGGCTCAAGAGAAATTCAACTTTGCTCGAGCAAAGTTGAATTTCTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2283s21c1
Sequence:CCGGGGGCACCTGAAGTTGACATTTCTCGAGAAATGTCAACTTCAGGTGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145857.2-2444s21c1
Sequence:CCGGAGCTCTGTATTTGCGAGATAACTCGAGTTATCTCGCAAATACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1752s1c1
Sequence:CCGGGCTCAGGTTGACTCTGATGATCTCGAGATCATCAGAGTCAACCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2633s1c1
Sequence:CCGGCCTTGCACACAAGCAGAACTTCTCGAGAAGTTCTGCTTGTGTGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-369s1c1
Sequence:CCGGGCCAACAGTCATACCTTTGAACTCGAGTTCAAAGGTATGACTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-2886s1c1
Sequence:CCGGCTGGAGAAGAACAAGTCACTACTCGAGTAGTGACTTGTTCTTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145857.1-1841s1c1
Sequence:CCGGGCACATTACCTTCCAGTGCTTCTCGAGAAGCACTGGAAGGTAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks