EMAIL THIS PAGE TO A FRIEND

NODAL

nodal growth differentiation factor

Synonyms: HTX5
UniProtKB ID: Q96S42, Q2M3A5, Q8N4V3
Gene ID:
Human(4838) Summary: The protein encoded by this gene is a member of the TGF-beta superfamily. Studies of the mouse counterpart suggested that this gene may be essential for mesoderm formation and subsequent organization of axial structures in early embryonic development. [provided by RefSeq, Jul 2008]
Mouse(18119) nodal
Rat(294503) nodal growth differentiation factor
chicken(395205) nodal homolog (mouse)
cow(530748) nodal homolog (mouse)
domestic cat(101096673) nodal homolog (mouse)
dog(489028) nodal homolog (mouse)
sheep(101110384) nodal homolog (mouse)
naked mole-rat(101716238) nodal growth differentiation factor
domestic guinea pig(100725590) nodal growth differentiation factor
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018055 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018055 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018055 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013611 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013611 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013611 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018055 Rosetta Predictions human pricing
NM_001106394 Rosetta Predictions rat pricing
NM_013611 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030929 predicted 1421
2 SASI_Hs01_00030930 predicted 1391
3 SASI_Hs01_00030931 predicted 398
4 SASI_Hs01_00030932 predicted 726
5 SASI_Hs01_00030933 predicted 966
6 SASI_Hs01_00030934 predicted 1096
7 SASI_Hs01_00030935 predicted 806
8 SASI_Hs01_00030937 predicted 1377
9 SASI_Hs01_00030938 predicted 242
10 SASI_Hs02_00351188 predicted 1315
11 SASI_Hs01_00030936 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218528 predicted 1585
2 SASI_Rn02_00218529 predicted 533
3 SASI_Rn02_00218530 predicted 1390
4 SASI_Rn02_00218531 predicted 408
5 SASI_Rn02_00218532 predicted 1030
6 SASI_Rn02_00218533 predicted 1607
7 SASI_Rn02_00218534 predicted 1579
8 SASI_Rn02_00218535 predicted 1008
9 SASI_Rn02_00218536 predicted 810
10 SASI_Rn02_00218537 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013611 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037912 predicted 373
2 SASI_Mm01_00037913 predicted 571
3 SASI_Mm01_00037914 predicted 385
4 SASI_Mm01_00037916 predicted 244
5 SASI_Mm01_00037918 predicted 720
6 SASI_Mm02_00322364 predicted 192
7 SASI_Mm01_00037919 predicted 433
8 SASI_Mm01_00037920 predicted 467
9 SASI_Mm01_00037921 predicted 412
10 SASI_Mm02_00322365 predicted 753
11 SASI_Mm01_00037915 predicted 206
12 SASI_Mm01_00037917 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018055
NODAL MISSION shRNA Bacterial Glycerol Stock
nodal growth differentiation factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-390s1c1
Sequence:CCGGGCGGTTTCAGATGGACCTATTCTCGAGAATAGGTCCATCTGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-564s1c1
Sequence:CCGGTGCCACCAATGTGCTCCTTATCTCGAGATAAGGAGCACATTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-1006s1c1
Sequence:CCGGCATAAAGACATGATCGTGGAACTCGAGTTCCACGATCATGTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-210s1c1
Sequence:CCGGGCAGAACTGGACGTTTGCTTTCTCGAGAAAGCAAACGTCCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-991s1c1
Sequence:CCGGGTGCTCCTAGATCACCATAAACTCGAGTTTATGGTGATCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-362s21c1
Sequence:CCGGGCTCACTTGCCATTGAGATTTCTCGAGAAATCTCAATGGCAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018055.4-1471s21c1
Sequence:CCGGCACCTATAGCTTTCATGTATTCTCGAGAATACATGAAAGCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-1007s21c1
Sequence:CCGGGCATGCTGTATGTGGATAATGCTCGAGCATTATCCACATACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018055
NODAL MISSION shRNA shRNA Plasmid DNA
nodal growth differentiation factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-390s1c1
Sequence:CCGGGCGGTTTCAGATGGACCTATTCTCGAGAATAGGTCCATCTGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-564s1c1
Sequence:CCGGTGCCACCAATGTGCTCCTTATCTCGAGATAAGGAGCACATTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-1006s1c1
Sequence:CCGGCATAAAGACATGATCGTGGAACTCGAGTTCCACGATCATGTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-210s1c1
Sequence:CCGGGCAGAACTGGACGTTTGCTTTCTCGAGAAAGCAAACGTCCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-991s1c1
Sequence:CCGGGTGCTCCTAGATCACCATAAACTCGAGTTTATGGTGATCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-362s21c1
Sequence:CCGGGCTCACTTGCCATTGAGATTTCTCGAGAAATCTCAATGGCAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018055.4-1471s21c1
Sequence:CCGGCACCTATAGCTTTCATGTATTCTCGAGAATACATGAAAGCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-1007s21c1
Sequence:CCGGGCATGCTGTATGTGGATAATGCTCGAGCATTATCCACATACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018055
NODAL MISSION shRNA Lentiviral Transduction Particles
nodal growth differentiation factor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-390s1c1
Sequence:CCGGGCGGTTTCAGATGGACCTATTCTCGAGAATAGGTCCATCTGAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-564s1c1
Sequence:CCGGTGCCACCAATGTGCTCCTTATCTCGAGATAAGGAGCACATTGGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-1006s1c1
Sequence:CCGGCATAAAGACATGATCGTGGAACTCGAGTTCCACGATCATGTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-210s1c1
Sequence:CCGGGCAGAACTGGACGTTTGCTTTCTCGAGAAAGCAAACGTCCAGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018055.3-991s1c1
Sequence:CCGGGTGCTCCTAGATCACCATAAACTCGAGTTTATGGTGATCTAGGAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-362s21c1
Sequence:CCGGGCTCACTTGCCATTGAGATTTCTCGAGAAATCTCAATGGCAAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018055.4-1471s21c1
Sequence:CCGGCACCTATAGCTTTCATGTATTCTCGAGAATACATGAAAGCTATAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018055.4-1007s21c1
Sequence:CCGGGCATGCTGTATGTGGATAATGCTCGAGCATTATCCACATACAGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013611
NODAL MISSION shRNA Bacterial Glycerol Stock
nodal growth differentiation factor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-823s1c1
Sequence:CCGGCCCAAGCAGTACAATGCCTATCTCGAGATAGGCATTGTACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-778s1c1
Sequence:CCGGCAGGTGGACTTCAACCTGATTCTCGAGAATCAGGTTGAAGTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-251s1c1
Sequence:CCGGGCCAAGAAGAGGATCTGGTATCTCGAGATACCAGATCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-219s1c1
Sequence:CCGGCTGGACTTTCACGTTTGACTTCTCGAGAAGTCAAACGTGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-731s1c1
Sequence:CCGGGACATCATTTGCCAGACAGAACTCGAGTTCTGTCTGGCAAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013611
NODAL MISSION shRNA shRNA Plasmid DNA
nodal growth differentiation factor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-823s1c1
Sequence:CCGGCCCAAGCAGTACAATGCCTATCTCGAGATAGGCATTGTACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-778s1c1
Sequence:CCGGCAGGTGGACTTCAACCTGATTCTCGAGAATCAGGTTGAAGTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-251s1c1
Sequence:CCGGGCCAAGAAGAGGATCTGGTATCTCGAGATACCAGATCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-219s1c1
Sequence:CCGGCTGGACTTTCACGTTTGACTTCTCGAGAAGTCAAACGTGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-731s1c1
Sequence:CCGGGACATCATTTGCCAGACAGAACTCGAGTTCTGTCTGGCAAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013611
NODAL MISSION shRNA Lentiviral Transduction Particles
nodal growth differentiation factor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-823s1c1
Sequence:CCGGCCCAAGCAGTACAATGCCTATCTCGAGATAGGCATTGTACTGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-778s1c1
Sequence:CCGGCAGGTGGACTTCAACCTGATTCTCGAGAATCAGGTTGAAGTCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-251s1c1
Sequence:CCGGGCCAAGAAGAGGATCTGGTATCTCGAGATACCAGATCCTCTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-219s1c1
Sequence:CCGGCTGGACTTTCACGTTTGACTTCTCGAGAAGTCAAACGTGAAAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013611.3-731s1c1
Sequence:CCGGGACATCATTTGCCAGACAGAACTCGAGTTCTGTCTGGCAAATGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks