EMAIL THIS PAGE TO A FRIEND

NOL12

nucleolar protein 12

Synonyms: Nop25 dJ37E16.7
UniProtKB ID: Q9UGY1
Gene ID:
Mouse(97961) nucleolar protein 12
Rat(362955) nucleolar protein 12
sheep(101101972) nucleolar protein 12
naked mole-rat(101718192) nucleolar protein 12
domestic guinea pig(100722633) nucleolar protein 12
Zebrafish(393260) nucleolar protein 12
cow(615252) nucleolar protein 12
domestic cat(101098393) nucleolar protein 12
chicken(418037) nucleolar protein 12
dog(608474) nucleolar protein 12
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003547 Anti-NOL12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2700648 Anti-NOL12 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024313 Rosetta Predictions human pricing
NM_001012747 Rosetta Predictions rat pricing
NM_133800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047858 predicted 983
2 SASI_Hs01_00047859 predicted 300
3 SASI_Hs01_00047860 predicted 1133
4 SASI_Hs02_00356655 predicted 976
5 SASI_Hs02_00356656 predicted 1149
6 SASI_Hs01_00047862 predicted 1108
7 SASI_Hs01_00047863 predicted 1098
8 SASI_Hs01_00047864 predicted 635
9 SASI_Hs01_00047865 predicted 979
10 SASI_Hs01_00047866 predicted 792
11 SASI_Hs01_00047861 predicted 997
12 SASI_Hs01_00047867 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069973 predicted 246
2 SASI_Rn01_00069974 predicted 298
3 SASI_Rn01_00069975 predicted 433
4 SASI_Rn01_00069977 predicted 513
5 SASI_Rn01_00069978 predicted 587
6 SASI_Rn01_00069979 predicted 327
7 SASI_Rn01_00069980 predicted 599
8 SASI_Rn01_00069981 predicted 332
9 SASI_Rn02_00200611 predicted 538
10 SASI_Rn01_00069982 predicted 348
11 SASI_Rn01_00069976 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093141 predicted 759
2 SASI_Mm01_00093142 predicted 1052
3 SASI_Mm01_00093143 predicted 968
4 SASI_Mm02_00338828 predicted 363
5 SASI_Mm01_00093145 predicted 1129
6 SASI_Mm01_00093146 predicted 629
7 SASI_Mm01_00093147 predicted 551
8 SASI_Mm01_00093148 predicted 206
9 SASI_Mm01_00093149 predicted 284
10 SASI_Mm02_00338829 predicted 192
11 SASI_Mm01_00093144 predicted 613
12 SASI_Mm01_00093150 predicted 1172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024313
VALIDATED
NOL12 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 12
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-525s1c1
Sequence:CCGGCACAGCATCACTACATGCACACTCGAGTGTGCATGTAGTGATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-228s1c1
Sequence:CCGGCCAGGAATACTTGAAGATGCTCTCGAGAGCATCTTCAAGTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-543s21c1
Sequence:CCGGTCCCTCACAGCATCACTACATCTCGAGATGTAGTGATGCTGTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-475s21c1
Sequence:CCGGCCACGGAGAAACCAACCAAAGCTCGAGCTTTGGTTGGTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024313.2-1394s21c1
Sequence:CCGGTCCCAACGTGGAAGGATTAATCTCGAGATTAATCCTTCCACGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-199s21c1
Sequence:CCGGAGATTAAGCAGCGGCTGAAAGCTCGAGCTTTCAGCCGCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-176s21c1
Sequence:CCGGGCGAAAGAAGGCAGCCATTGACTCGAGTCAATGGCTGCCTTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024313
VALIDATED
NOL12 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 12
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-525s1c1
Sequence:CCGGCACAGCATCACTACATGCACACTCGAGTGTGCATGTAGTGATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-228s1c1
Sequence:CCGGCCAGGAATACTTGAAGATGCTCTCGAGAGCATCTTCAAGTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-543s21c1
Sequence:CCGGTCCCTCACAGCATCACTACATCTCGAGATGTAGTGATGCTGTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-475s21c1
Sequence:CCGGCCACGGAGAAACCAACCAAAGCTCGAGCTTTGGTTGGTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024313.2-1394s21c1
Sequence:CCGGTCCCAACGTGGAAGGATTAATCTCGAGATTAATCCTTCCACGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-199s21c1
Sequence:CCGGAGATTAAGCAGCGGCTGAAAGCTCGAGCTTTCAGCCGCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-176s21c1
Sequence:CCGGGCGAAAGAAGGCAGCCATTGACTCGAGTCAATGGCTGCCTTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024313
VALIDATED
NOL12 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 12
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181091    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-525s1c1
Sequence:CCGGCACAGCATCACTACATGCACACTCGAGTGTGCATGTAGTGATGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179897    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024313.1-228s1c1
Sequence:CCGGCCAGGAATACTTGAAGATGCTCTCGAGAGCATCTTCAAGTATTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-543s21c1
Sequence:CCGGTCCCTCACAGCATCACTACATCTCGAGATGTAGTGATGCTGTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-475s21c1
Sequence:CCGGCCACGGAGAAACCAACCAAAGCTCGAGCTTTGGTTGGTTTCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024313.2-1394s21c1
Sequence:CCGGTCCCAACGTGGAAGGATTAATCTCGAGATTAATCCTTCCACGTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-199s21c1
Sequence:CCGGAGATTAAGCAGCGGCTGAAAGCTCGAGCTTTCAGCCGCTGCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_024313.2-176s21c1
Sequence:CCGGGCGAAAGAAGGCAGCCATTGACTCGAGTCAATGGCTGCCTTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133800
NOL12 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 12
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-218s1c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-114s1c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-219s1c1
Sequence:CCGGCTTAAGCAAGAGCAGAAGAAACTCGAGTTTCTTCTGCTCTTGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-582s1c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-228s1c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-226s21c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-112s21c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-580s21c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-216s21c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133800
NOL12 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 12
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-218s1c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-114s1c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-219s1c1
Sequence:CCGGCTTAAGCAAGAGCAGAAGAAACTCGAGTTTCTTCTGCTCTTGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-582s1c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-228s1c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-226s21c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-112s21c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-580s21c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-216s21c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133800
NOL12 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 12
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-218s1c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-114s1c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-219s1c1
Sequence:CCGGCTTAAGCAAGAGCAGAAGAAACTCGAGTTTCTTCTGCTCTTGCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-582s1c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133800.2-228s1c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-226s21c1
Sequence:CCGGGAGCAGAAGAAACTTCGGGAACTCGAGTTCCCGAAGTTTCTTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-112s21c1
Sequence:CCGGCTCGTTCTCAACTTTGATGAACTCGAGTTCATCAAAGTTGAGAACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-580s21c1
Sequence:CCGGCGGAAGAAGGTCAAGAGGAAACTCGAGTTTCCTCTTGACCTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133800.3-216s21c1
Sequence:CCGGGCTTAAGCAAGAGCAGAAGAACTCGAGTTCTTCTGCTCTTGCTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks