EMAIL THIS PAGE TO A FRIEND

NOL3

nucleolar protein 3 (apoptosis repressor with CARD domain)

Synonyms: ARC FCM MYP NOP NOP30
UniProtKB ID: O60936, O60937
Gene ID:
Human(8996) Summary: This gene encodes an anti-apoptotic protein that has been shown to down-regulate the enzyme activities of caspase 2, caspase 8 and tumor protein p53. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Mouse(78688) nucleolar protein 3 (apoptosis repressor with CARD domain)
Rat(85383) nucleolar protein 3 (apoptosis repressor with CARD domain)
domestic cat(101088041) nucleolar protein 3 (apoptosis repressor with CARD domain)
cow(515777) nucleolar protein 3 (apoptosis repressor with CARD domain)
dog(611249) nucleolar protein 3 (apoptosis repressor with CARD domain)
domestic guinea pig(100732676) nucleolar protein 3 (apoptosis repressor with CARD domain)
naked mole-rat(101721210) nucleolar protein 3 (apoptosis repressor with CARD domain)
sheep(101106709) nucleolar protein 3 (apoptosis repressor with CARD domain)
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030152 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030152 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030152 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003946 Rosetta Predictions human pricing
NM_053516 Rosetta Predictions rat pricing
NM_030152 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068137 predicted 952
2 SASI_Hs01_00068138 predicted 1081
3 SASI_Hs01_00068139 predicted 1116
4 SASI_Hs01_00068140 predicted 1153
5 SASI_Hs01_00068141 predicted 225
6 SASI_Hs01_00068142 predicted 218
7 SASI_Hs01_00068143 predicted 1078
8 SASI_Hs01_00068144 predicted 1089
9 SASI_Hs01_00068145 predicted 891
10 SASI_Hs02_00336604 predicted 972
11 SASI_Hs01_00068146 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117448 predicted 1214
2 SASI_Rn01_00117449 predicted 960
3 SASI_Rn01_00117450 predicted 262
4 SASI_Rn01_00117451 predicted 1216
5 SASI_Rn01_00117452 predicted 1092
6 SASI_Rn01_00117453 predicted 1208
7 SASI_Rn02_00266125 predicted 1102
8 SASI_Rn01_00117454 predicted 1203
9 SASI_Rn01_00117455 predicted 1027
10 SASI_Rn01_00117456 predicted 1075
11 SASI_Rn01_00117457 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030152 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097156 predicted 1290
2 SASI_Mm01_00097157 predicted 1297
3 SASI_Mm01_00097158 predicted 196
4 SASI_Mm01_00097159 predicted 1075
5 SASI_Mm01_00097160 predicted 1293
6 SASI_Mm01_00097162 predicted 1181
7 SASI_Mm02_00336562 predicted 303
8 SASI_Mm02_00336563 predicted 1327
9 SASI_Mm01_00097164 predicted 1019
10 SASI_Mm02_00336564 predicted 230
11 SASI_Mm01_00097155 predicted 212
12 SASI_Mm01_00097161 predicted 1019
13 SASI_Mm01_00097163 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003946
NOL3 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 3 (apoptosis repressor with CARD domain)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-954s21c1
Sequence:CCGGCATCCAGTCCTCAGCCCTAATCTCGAGATTAGGGCTGAGGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-119s21c1
Sequence:CCGGACTATCGACCGCGAGCGGAAACTCGAGTTTCCGCTCGCGGTCGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-812s21c1
Sequence:CCGGCAGTACCGCTGGAAGTGAATACTCGAGTATTCACTTCCAGCGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-703s21c1
Sequence:CCGGCGAAGATTCCTGAAGGCCAGACTCGAGTCTGGCCTTCAGGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003946.3-1250s1c1
Sequence:CCGGGCCACACACATCATTGTCATTCTCGAGAATGACAATGATGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-557s1c1
Sequence:CCGGCTGGAAGCTGAGGCCTCTAAACTCGAGTTTAGAGGCCTCAGCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-227s1c1
Sequence:CCGGGCATTGGATGCACTGCCTGATCTCGAGATCAGGCAGTGCATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-689s1c1
Sequence:CCGGGAAAGGGACGAGTCCGAAGATCTCGAGATCTTCGGACTCGTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-393s1c1
Sequence:CCGGACCGCAGCTATGACCCTCCATCTCGAGATGGAGGGTCATAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003946
NOL3 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 3 (apoptosis repressor with CARD domain)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-954s21c1
Sequence:CCGGCATCCAGTCCTCAGCCCTAATCTCGAGATTAGGGCTGAGGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-119s21c1
Sequence:CCGGACTATCGACCGCGAGCGGAAACTCGAGTTTCCGCTCGCGGTCGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-812s21c1
Sequence:CCGGCAGTACCGCTGGAAGTGAATACTCGAGTATTCACTTCCAGCGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-703s21c1
Sequence:CCGGCGAAGATTCCTGAAGGCCAGACTCGAGTCTGGCCTTCAGGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003946.3-1250s1c1
Sequence:CCGGGCCACACACATCATTGTCATTCTCGAGAATGACAATGATGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-557s1c1
Sequence:CCGGCTGGAAGCTGAGGCCTCTAAACTCGAGTTTAGAGGCCTCAGCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-227s1c1
Sequence:CCGGGCATTGGATGCACTGCCTGATCTCGAGATCAGGCAGTGCATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-689s1c1
Sequence:CCGGGAAAGGGACGAGTCCGAAGATCTCGAGATCTTCGGACTCGTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-393s1c1
Sequence:CCGGACCGCAGCTATGACCCTCCATCTCGAGATGGAGGGTCATAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003946
NOL3 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 3 (apoptosis repressor with CARD domain)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442066    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-954s21c1
Sequence:CCGGCATCCAGTCCTCAGCCCTAATCTCGAGATTAGGGCTGAGGACTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-119s21c1
Sequence:CCGGACTATCGACCGCGAGCGGAAACTCGAGTTTCCGCTCGCGGTCGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003946.3-812s21c1
Sequence:CCGGCAGTACCGCTGGAAGTGAATACTCGAGTATTCACTTCCAGCGGTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003946.3-703s21c1
Sequence:CCGGCGAAGATTCCTGAAGGCCAGACTCGAGTCTGGCCTTCAGGAATCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003946.3-1250s1c1
Sequence:CCGGGCCACACACATCATTGTCATTCTCGAGAATGACAATGATGTGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-557s1c1
Sequence:CCGGCTGGAAGCTGAGGCCTCTAAACTCGAGTTTAGAGGCCTCAGCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-227s1c1
Sequence:CCGGGCATTGGATGCACTGCCTGATCTCGAGATCAGGCAGTGCATCCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-689s1c1
Sequence:CCGGGAAAGGGACGAGTCCGAAGATCTCGAGATCTTCGGACTCGTCCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003946.3-393s1c1
Sequence:CCGGACCGCAGCTATGACCCTCCATCTCGAGATGGAGGGTCATAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030152
NOL3 MISSION shRNA Bacterial Glycerol Stock
nucleolar protein 3 (apoptosis repressor with CARD domain)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030152.2-1552s1c1
Sequence:CCGGCCGCTGAATCTGAAGTGAAATCTCGAGATTTCACTTCAGATTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-297s1c1
Sequence:CCGGCCCGAGTACGAAGCCTTGGATCTCGAGATCCAAGGCTTCGTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-675s1c1
Sequence:CCGGCAAGAAATGAATCCAGAACAACTCGAGTTGTTCTGGATTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-624s1c1
Sequence:CCGGGAGCCAGAACTAGAAGCTGAACTCGAGTTCAGCTTCTAGTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-795s1c1
Sequence:CCGGCCCGACTTCCAAGAAGAGGATCTCGAGATCCTCTTCTTGGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030152
NOL3 MISSION shRNA shRNA Plasmid DNA
nucleolar protein 3 (apoptosis repressor with CARD domain)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030152.2-1552s1c1
Sequence:CCGGCCGCTGAATCTGAAGTGAAATCTCGAGATTTCACTTCAGATTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-297s1c1
Sequence:CCGGCCCGAGTACGAAGCCTTGGATCTCGAGATCCAAGGCTTCGTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-675s1c1
Sequence:CCGGCAAGAAATGAATCCAGAACAACTCGAGTTGTTCTGGATTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-624s1c1
Sequence:CCGGGAGCCAGAACTAGAAGCTGAACTCGAGTTCAGCTTCTAGTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-795s1c1
Sequence:CCGGCCCGACTTCCAAGAAGAGGATCTCGAGATCCTCTTCTTGGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030152
NOL3 MISSION shRNA Lentiviral Transduction Particles
nucleolar protein 3 (apoptosis repressor with CARD domain)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030152.2-1552s1c1
Sequence:CCGGCCGCTGAATCTGAAGTGAAATCTCGAGATTTCACTTCAGATTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-297s1c1
Sequence:CCGGCCCGAGTACGAAGCCTTGGATCTCGAGATCCAAGGCTTCGTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-675s1c1
Sequence:CCGGCAAGAAATGAATCCAGAACAACTCGAGTTGTTCTGGATTCATTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-624s1c1
Sequence:CCGGGAGCCAGAACTAGAAGCTGAACTCGAGTTCAGCTTCTAGTTCTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030152.2-795s1c1
Sequence:CCGGCCCGACTTCCAAGAAGAGGATCTCGAGATCCTCTTCTTGGAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks