EMAIL THIS PAGE TO A FRIEND

NOP58

NOP58 ribonucleoprotein

Synonyms: NOP5 NOP5/NOP58
UniProtKB ID: Q9Y2X3, Q53SA4, Q6PK08, Q9P036, Q9UFN3
Gene ID:
Mouse(55989) NOP58 ribonucleoprotein
Rat(60373) NOP58 ribonucleoprotein
Zebrafish(494152) NOP58 ribonucleoprotein homolog (yeast)
chicken(424087) NOP58 ribonucleoprotein homolog (yeast)
dog(607667) NOP58 ribonucleoprotein homolog (yeast)
domestic cat(101096089) NOP58 ribonucleoprotein homolog (yeast)
cow(507155) NOP58 ribonucleoprotein homolog (yeast)
Horse(100067129) NOP58 ribonucleoprotein homolog (yeast)
sheep(101110999) NOP58 ribonucleoprotein homolog (yeast)
naked mole-rat(101703263) NOP58 ribonucleoprotein
Domestic Rabbit(100350995) NOP58 ribonucleoprotein homolog (yeast)
domestic guinea pig(100735951) NOP58 ribonucleoprotein
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015934 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015934 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015934 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015934 Rosetta Predictions human pricing
NM_021754 Rosetta Predictions rat pricing
NM_018868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015934 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348568 predicted 715
2 SASI_Hs01_00095914 predicted 590
3 SASI_Hs01_00095915 predicted 209
4 SASI_Hs01_00095916 predicted 1127
5 SASI_Hs01_00095917 predicted 311
6 SASI_Hs01_00095919 predicted 391
7 SASI_Hs01_00095920 predicted 778
8 SASI_Hs02_00348569 predicted 1216
9 SASI_Hs01_00095921 predicted 205
10 SASI_Hs01_00095922 predicted 698
11 SASI_Hs01_00095918 predicted 990
12 SASI_Hs01_00095923 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036040 predicted 483
2 SASI_Rn02_00262813 predicted 719
3 SASI_Rn02_00262814 predicted 1091
4 SASI_Rn01_00036042 predicted 1272
5 SASI_Rn01_00036044 predicted 922
6 SASI_Rn01_00036045 predicted 218
7 SASI_Rn01_00036046 predicted 1004
8 SASI_Rn01_00036047 predicted 699
9 SASI_Rn01_00036048 predicted 309
10 SASI_Rn01_00036049 predicted 1174
11 SASI_Rn01_00036041 predicted 608
12 SASI_Rn01_00036043 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180818 predicted 489
2 SASI_Mm01_00180819 predicted 1095
3 SASI_Mm01_00180820 predicted 669
4 SASI_Mm01_00180822 predicted 914
5 SASI_Mm01_00180823 predicted 1189
6 SASI_Mm02_00324245 predicted 329
7 SASI_Mm02_00324246 predicted 227
8 SASI_Mm01_00180826 predicted 712
9 SASI_Mm01_00180827 predicted 1014
10 SASI_Mm02_00324247 predicted 316
11 SASI_Mm01_00180821 predicted 1230
12 SASI_Mm01_00180824 predicted 867
13 SASI_Mm01_00180825 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018868
NOP58 MISSION shRNA Bacterial Glycerol Stock
NOP58 ribonucleoprotein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-1633s1c1
Sequence:CCGGGCAGTTCCTAGTCCAGAGAAACTCGAGTTTCTCTGGACTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-1136s1c1
Sequence:CCGGCCAAACACAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1717s1c1
Sequence:CCGGCCGAACACATCATGCTTACGACTCGAGTCGTAAGCATGATGTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-836s1c1
Sequence:CCGGGCAACATTCTACATCTGTGTACTCGAGTACACAGATGTAGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-519s1c1
Sequence:CCGGGTCTCGATACAGATTGAAATTCTCGAGAATTTCAATCTGTATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1724s1c1
Sequence:CCGGCATCATGCTTACGATTCAGTTCTCGAGAACTGAATCGTAAGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-581s1c1
Sequence:CCGGCCTTATTAGATGACTTGGATACTCGAGTATCCAAGTCATCTAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-236s1c1
Sequence:CCGGGAAACTTCAAGAGGTTGATAGCTCGAGCTATCAACCTCTTGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-780s1c1
Sequence:CCGGCTGACATACTGCAAGTGTTTACTCGAGTAAACACTTGCAGTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-1168s1c1
Sequence:CCGGCTAGACGAGACACACCTAAATCTCGAGATTTAGGTGTGTCTCGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018868
NOP58 MISSION shRNA shRNA Plasmid DNA
NOP58 ribonucleoprotein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-1633s1c1
Sequence:CCGGGCAGTTCCTAGTCCAGAGAAACTCGAGTTTCTCTGGACTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-1136s1c1
Sequence:CCGGCCAAACACAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1717s1c1
Sequence:CCGGCCGAACACATCATGCTTACGACTCGAGTCGTAAGCATGATGTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-836s1c1
Sequence:CCGGGCAACATTCTACATCTGTGTACTCGAGTACACAGATGTAGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-519s1c1
Sequence:CCGGGTCTCGATACAGATTGAAATTCTCGAGAATTTCAATCTGTATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1724s1c1
Sequence:CCGGCATCATGCTTACGATTCAGTTCTCGAGAACTGAATCGTAAGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-581s1c1
Sequence:CCGGCCTTATTAGATGACTTGGATACTCGAGTATCCAAGTCATCTAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-236s1c1
Sequence:CCGGGAAACTTCAAGAGGTTGATAGCTCGAGCTATCAACCTCTTGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-780s1c1
Sequence:CCGGCTGACATACTGCAAGTGTTTACTCGAGTAAACACTTGCAGTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-1168s1c1
Sequence:CCGGCTAGACGAGACACACCTAAATCTCGAGATTTAGGTGTGTCTCGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018868
NOP58 MISSION shRNA Lentiviral Transduction Particles
NOP58 ribonucleoprotein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-1633s1c1
Sequence:CCGGGCAGTTCCTAGTCCAGAGAAACTCGAGTTTCTCTGGACTAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-1136s1c1
Sequence:CCGGCCAAACACAAAGGAAAGATTTCTCGAGAAATCTTTCCTTTGTGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1717s1c1
Sequence:CCGGCCGAACACATCATGCTTACGACTCGAGTCGTAAGCATGATGTGTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-836s1c1
Sequence:CCGGGCAACATTCTACATCTGTGTACTCGAGTACACAGATGTAGAATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.1-519s1c1
Sequence:CCGGGTCTCGATACAGATTGAAATTCTCGAGAATTTCAATCTGTATCGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197520    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018868.1-1724s1c1
Sequence:CCGGCATCATGCTTACGATTCAGTTCTCGAGAACTGAATCGTAAGCATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018868.1-581s1c1
Sequence:CCGGCCTTATTAGATGACTTGGATACTCGAGTATCCAAGTCATCTAATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216547    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-236s1c1
Sequence:CCGGGAAACTTCAAGAGGTTGATAGCTCGAGCTATCAACCTCTTGAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-780s1c1
Sequence:CCGGCTGACATACTGCAAGTGTTTACTCGAGTAAACACTTGCAGTATGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216638    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018868.2-1168s1c1
Sequence:CCGGCTAGACGAGACACACCTAAATCTCGAGATTTAGGTGTGTCTCGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015934
VALIDATED
NOP58 MISSION shRNA Bacterial Glycerol Stock
NOP58 ribonucleoprotein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1133s1c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1754s1c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1000s1c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015934.3-612s1c1
Sequence:CCGGCGCTGATAAAGTAGACACAATCTCGAGATTGTGTCTACTTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1754s21c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1027s21c1
Sequence:CCGGTTAGTTGGAGCACGGCTTATTCTCGAGAATAAGCCGTGCTCCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1000s21c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-214s21c1
Sequence:CCGGCTTCAAGAGGTTGATAGTTTACTCGAGTAAACTATCAACCTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1133s21c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015934
VALIDATED
NOP58 MISSION shRNA shRNA Plasmid DNA
NOP58 ribonucleoprotein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1133s1c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1754s1c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1000s1c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015934.3-612s1c1
Sequence:CCGGCGCTGATAAAGTAGACACAATCTCGAGATTGTGTCTACTTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1754s21c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1027s21c1
Sequence:CCGGTTAGTTGGAGCACGGCTTATTCTCGAGAATAAGCCGTGCTCCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1000s21c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-214s21c1
Sequence:CCGGCTTCAAGAGGTTGATAGTTTACTCGAGTAAACTATCAACCTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1133s21c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015934
VALIDATED
NOP58 MISSION shRNA Lentiviral Transduction Particles
NOP58 ribonucleoprotein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1133s1c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155782    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1754s1c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015934.3-1000s1c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152108    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015934.3-612s1c1
Sequence:CCGGCGCTGATAAAGTAGACACAATCTCGAGATTGTGTCTACTTTATCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319192    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1754s21c1
Sequence:CCGGCGATTATATCACCCGGACACACTCGAGTGTGTCCGGGTGATATAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1027s21c1
Sequence:CCGGTTAGTTGGAGCACGGCTTATTCTCGAGAATAAGCCGTGCTCCAACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1000s21c1
Sequence:CCGGCCCAATGTTACAGTCATGGTTCTCGAGAACCATGACTGTAACATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-214s21c1
Sequence:CCGGCTTCAAGAGGTTGATAGTTTACTCGAGTAAACTATCAACCTCTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_015934.3-1133s21c1
Sequence:CCGGCCCTCAAATCTAGACGGGATACTCGAGTATCCCGTCTAGATTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks