EMAIL THIS PAGE TO A FRIEND

NOS3

nitric oxide synthase 3 (endothelial cell)

Synonyms: ECNOS eNOS
Gene ID:
Human(4846) Summary: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. Nitric oxide is synthesized from L-arginine by nitric oxide synthases. Variations in this gene are associated with susceptibility to coronary spasm. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Mouse(18127) nitric oxide synthase 3, endothelial cell
Rat(24600) nitric oxide synthase 3, endothelial cell
chicken(100858754) endothelial nitric oxide synthase 3
cow(287024) nitric oxide synthase 3 (endothelial cell)
Horse(100063339) nitric oxide synthase 3 (endothelial cell)
domestic cat(101096463) nitric oxide synthase 3 (endothelial cell)
dog(403784) nitric oxide synthase 3 (endothelial cell)
naked mole-rat(101711110) nitric oxide synthase 3 (endothelial cell)
Domestic Rabbit(100009498) nitric oxide synthase 3 (endothelial cell)
domestic guinea pig(100135577) nitric oxide synthase 3, endothelial cell
sheep(443073) nitric oxide synthase 3 (endothelial cell)
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305369 ANTI-ENOS (S1177) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunofluorescence, western blot pricing
SAB4502013 Anti-ENOS antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502016 Anti-ENOS antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4502014 Anti-ENOS, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB4502015 Anti-ENOS, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
N3893 Anti-Nitric Oxide Synthase, Endothelial (1185-1205) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, mouse, rat, human
immunohistochemistry, microarray, western blot pricing
N2643 Anti-Nitric Oxide Synthase, Endothelial (596-609) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution bovine, human, mouse
immunohistochemistry, microarray, western blot pricing
N217 Anti-Nitric Oxide Synthase, Universal antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, bovine, pig, mouse, rat
immunohistochemistry, western blot pricing
SAB4300435 Anti-NOS3 (Ab-1177) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4300491 Anti-NOS3 (Ab-495) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunofluorescence pricing
SAB1406188 Anti-NOS3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB4504393 Anti-phospho-eNOS (pSer1176) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504277 Anti-phospho-eNOS (pSer615) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504394 Anti-phospho-eNOS (pThr494) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301277 Anti-phospho-eNOS (pThr494) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1305091 ANTI-PHOSPHO-ENOS(S1177) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence pricing
SAB4300128 Anti-phospho-NOS3 (pSer1177) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunofluorescence, immunohistochemistry pricing
N9532 Monoclonal Anti-Nitric Oxide Synthase, Endothelial antibody produced in mouse clone NOS-E1, ascites fluid rat, human, mouse, bovine
microarray, western blot pricing
SAB5300409 Monoclonal Anti-NOS3 antibody produced in mouse clone 6H2, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB1402291 Monoclonal Anti-NOS3 antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0547 Pentamidine isethionate salt powder human pricing

Small Molecule - Cofactor

Product # Description Species Add to Cart
 
S154 Sepiapterin solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008713 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008713 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008713 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
07-520 Anti-eNOS/NOS III Antibody, CT 200 µg, Anti-eNOS/NOS III Antibody, CT detects level of eNOS/NOS III & has been published & validated for use in WB. pricing
AB16301 Anti-Nitric Oxide Synthase III Antibody 100 µg, Anti-Nitric Oxide Synthase III Antibody detects level of Nitric Oxide Synthase III & has been published & validated for use in WB & IC. pricing
07-428-I Anti-phospho eNOS Antibody (Ser1177) 200 µL, Anti-phospho eNOS Antibody (Ser1177) is a highly specific rabbit polyclonal antibody, that targets eNOS/NOS III & has been tested in western blotting. pricing
07-357 Anti-phospho-eNOS/NOS III (Ser114) Antibody 100 µL, Detect phospho-eNOS/NOS III (Ser114) using this Anti-phospho-eNOS/NOS III (Ser114) Antibody validated for use in WB. pricing
07-561 Anti-phospho-eNOS/NOS III (Ser617) Antibody 200 µL, Anti-phospho-eNOS/NOS III (Ser617) Antibody detects level of phospho-eNOS/NOS III (Ser617) & has been published & validated for use in WB. pricing
07-562 Anti-phospho-eNOS/NOS III (Ser635) Antibody 200 µL, Anti-phospho-eNOS/NOS III (Ser635) Antibody is an antibody against phospho-eNOS/NOS III (Ser635) for use in WB. pricing
04-811 Anti-phospho-eNOS/NOS III (Thr495) Antibody, rabbit monoclonal 100 µL, This Anti-phospho-eNOS/NOS III (Thr495) Antibody is validated for use in WB for the detection of phospho-eNOS/NOS III (Thr495). pricing
ABS1631 Anti-phospho-eNOS (Ser602) 100 µL, Detect endothelial Nitric oxide synthase using this rabbit polyclonal Anti-phospho-eNOS (Ser602), Cat. No. ABS1631. It has been tested for use in ELISA and Western Blotting. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000603 Rosetta Predictions human pricing
NM_021838 Rosetta Predictions rat pricing
NM_008713 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174420 predicted 910
2 SASI_Hs01_00174421 predicted 1514
3 SASI_Hs01_00174422 predicted 2109
4 SASI_Hs01_00174424 predicted 1906
5 SASI_Hs01_00174425 predicted 1840
6 SASI_Hs01_00174428 predicted 898
7 SASI_Hs02_00302890 predicted 1991
8 SASI_Hs02_00302891 predicted 3788
9 SASI_Hs02_00302892 predicted 1004
10 SASI_Hs02_00302893 predicted 1364
11 SASI_Hs01_00174419 predicted 485
12 SASI_Hs01_00174423 predicted 1770
13 SASI_Hs01_00174426 predicted 695
14 SASI_Hs01_00174427 predicted 3497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021838 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262839 predicted 628
2 SASI_Rn02_00262840 predicted 2268
3 SASI_Rn02_00262841 predicted 809
4 SASI_Rn02_00262842 predicted 3085
5 SASI_Rn02_00262843 predicted 3212
6 SASI_Rn02_00262844 predicted 1883
7 SASI_Rn02_00262845 predicted 2229
8 SASI_Rn02_00262846 predicted 2159
9 SASI_Rn02_00262847 predicted 2333
10 SASI_Rn02_00262848 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008713 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082235 predicted 650
2 SASI_Mm01_00082236 predicted 1019
3 SASI_Mm02_00314550 predicted 723
4 SASI_Mm01_00082237 predicted 748
5 SASI_Mm02_00314551 predicted 633
6 SASI_Mm01_00082238 predicted 2158
7 SASI_Mm01_00082239 predicted 408
8 SASI_Mm01_00082241 predicted 1488
9 SASI_Mm01_00082242 predicted 2763
10 SASI_Mm01_00082243 predicted 1678
11 SASI_Mm01_00082240 predicted 642
12 SASI_Mm01_00082244 predicted 2254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000603
VALIDATED
NOS3 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 3 (endothelial cell)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3629s21c1
Sequence:CCGGGTTTGTCTGCGGCGATGTTACCTCGAGGTAACATCGCCGCAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000603.4-4001s21c1
Sequence:CCGGGTGGTGCCTTCTCACATCTGTCTCGAGACAGATGTGAGAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3164s21c1
Sequence:CCGGTGTAGCTGTGCTGGCATACAGCTCGAGCTGTATGCCAGCACAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2566s21c1
Sequence:CCGGAGATGTTCCAGGCTACAATCCCTCGAGGGATTGTAGCCTGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1999s21c1
Sequence:CCGGTGGTGGTAACCAGCACATTTGCTCGAGCAAATGTGCTGGTTACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-928s21c1
Sequence:CCGGTCTGCAACCACATCAAGTATGCTCGAGCATACTTGATGTGGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2182s21c1
Sequence:CCGGAGAGGAAGGAGTCCAGTAACACTCGAGTGTTACTGGACTCCTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1400s21c1
Sequence:CCGGTGACCCTCACCGCTACAACATCTCGAGATGTTGTAGCGGTGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-3749s1c1
Sequence:CCGGCAACGCTACCACGAAGACATTCTCGAGAATGTCTTCGTGGTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-1940s1c1
Sequence:CCGGGTCCTGTGTATGGATGAGTATCTCGAGATACTCATCCATACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-2099s1c1
Sequence:CCGGCCGGAACAGCACAAGAGTTATCTCGAGATAACTCTTGTGCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-688s1c1
Sequence:CCGGCCAGTACTACAGCTCCATTAACTCGAGTTAATGGAGCTGTAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-1673s1c1
Sequence:CCGGCATCAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000603
VALIDATED
NOS3 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 3 (endothelial cell)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3629s21c1
Sequence:CCGGGTTTGTCTGCGGCGATGTTACCTCGAGGTAACATCGCCGCAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000603.4-4001s21c1
Sequence:CCGGGTGGTGCCTTCTCACATCTGTCTCGAGACAGATGTGAGAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3164s21c1
Sequence:CCGGTGTAGCTGTGCTGGCATACAGCTCGAGCTGTATGCCAGCACAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2566s21c1
Sequence:CCGGAGATGTTCCAGGCTACAATCCCTCGAGGGATTGTAGCCTGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1999s21c1
Sequence:CCGGTGGTGGTAACCAGCACATTTGCTCGAGCAAATGTGCTGGTTACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-928s21c1
Sequence:CCGGTCTGCAACCACATCAAGTATGCTCGAGCATACTTGATGTGGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2182s21c1
Sequence:CCGGAGAGGAAGGAGTCCAGTAACACTCGAGTGTTACTGGACTCCTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1400s21c1
Sequence:CCGGTGACCCTCACCGCTACAACATCTCGAGATGTTGTAGCGGTGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-3749s1c1
Sequence:CCGGCAACGCTACCACGAAGACATTCTCGAGAATGTCTTCGTGGTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-1940s1c1
Sequence:CCGGGTCCTGTGTATGGATGAGTATCTCGAGATACTCATCCATACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-2099s1c1
Sequence:CCGGCCGGAACAGCACAAGAGTTATCTCGAGATAACTCTTGTGCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-688s1c1
Sequence:CCGGCCAGTACTACAGCTCCATTAACTCGAGTTAATGGAGCTGTAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-1673s1c1
Sequence:CCGGCATCAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000603
VALIDATED
NOS3 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 3 (endothelial cell)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3629s21c1
Sequence:CCGGGTTTGTCTGCGGCGATGTTACCTCGAGGTAACATCGCCGCAGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000603.4-4001s21c1
Sequence:CCGGGTGGTGCCTTCTCACATCTGTCTCGAGACAGATGTGAGAAGGCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-3164s21c1
Sequence:CCGGTGTAGCTGTGCTGGCATACAGCTCGAGCTGTATGCCAGCACAGCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2566s21c1
Sequence:CCGGAGATGTTCCAGGCTACAATCCCTCGAGGGATTGTAGCCTGGAACATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1999s21c1
Sequence:CCGGTGGTGGTAACCAGCACATTTGCTCGAGCAAATGTGCTGGTTACCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-928s21c1
Sequence:CCGGTCTGCAACCACATCAAGTATGCTCGAGCATACTTGATGTGGTTGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-2182s21c1
Sequence:CCGGAGAGGAAGGAGTCCAGTAACACTCGAGTGTTACTGGACTCCTTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000603.4-1400s21c1
Sequence:CCGGTGACCCTCACCGCTACAACATCTCGAGATGTTGTAGCGGTGAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-3749s1c1
Sequence:CCGGCAACGCTACCACGAAGACATTCTCGAGAATGTCTTCGTGGTAGCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-1940s1c1
Sequence:CCGGGTCCTGTGTATGGATGAGTATCTCGAGATACTCATCCATACACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000603.2-2099s1c1
Sequence:CCGGCCGGAACAGCACAAGAGTTATCTCGAGATAACTCTTGTGCTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-688s1c1
Sequence:CCGGCCAGTACTACAGCTCCATTAACTCGAGTTAATGGAGCTGTAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A3
TRC Version: 1 Clone ID:NM_000603.2-1673s1c1
Sequence:CCGGCATCAGGAGATGGTCAACTATCTCGAGATAGTTGACCATCTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008713
NOS3 MISSION shRNA Bacterial Glycerol Stock
nitric oxide synthase 3 (endothelial cell)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008713.4-3893s21c1
Sequence:CCGGCTGGAGTATCTTACGTTTAAACTCGAGTTTAAACGTAAGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-760s21c1
Sequence:CCGGGATACGCTATGCGGGCTATAGCTCGAGCTATAGCCCGCATAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-402s21c1
Sequence:CCGGACTTCATCAATCAGTACTATACTCGAGTATAGTACTGATTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-1398s21c1
Sequence:CCGGATCAAGAGATGGTCAACTATTCTCGAGAATAGTTGACCATCTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008713.2-3844s1c1
Sequence:CCGGGCCCTCTTCATATGCTTTGATCTCGAGATCAAAGCATATGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-1126s1c1
Sequence:CCGGCCTCACCGCTACAACATACTTCTCGAGAAGTATGTTGTAGCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-2715s1c1
Sequence:CCGGCTACGAAGAATGGAAGTGGTTCTCGAGAACCACTTCCATTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-324s1c1
Sequence:CCGGCCTGGTGTTTCCAAGGAAGTTCTCGAGAACTTCCTTGGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-657s1c1
Sequence:CCGGCCACATTAAATACGCAACAAACTCGAGTTTGTTGCGTATTTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008713
NOS3 MISSION shRNA shRNA Plasmid DNA
nitric oxide synthase 3 (endothelial cell)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008713.4-3893s21c1
Sequence:CCGGCTGGAGTATCTTACGTTTAAACTCGAGTTTAAACGTAAGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-760s21c1
Sequence:CCGGGATACGCTATGCGGGCTATAGCTCGAGCTATAGCCCGCATAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-402s21c1
Sequence:CCGGACTTCATCAATCAGTACTATACTCGAGTATAGTACTGATTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-1398s21c1
Sequence:CCGGATCAAGAGATGGTCAACTATTCTCGAGAATAGTTGACCATCTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008713.2-3844s1c1
Sequence:CCGGGCCCTCTTCATATGCTTTGATCTCGAGATCAAAGCATATGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-1126s1c1
Sequence:CCGGCCTCACCGCTACAACATACTTCTCGAGAAGTATGTTGTAGCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-2715s1c1
Sequence:CCGGCTACGAAGAATGGAAGTGGTTCTCGAGAACCACTTCCATTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-324s1c1
Sequence:CCGGCCTGGTGTTTCCAAGGAAGTTCTCGAGAACTTCCTTGGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-657s1c1
Sequence:CCGGCCACATTAAATACGCAACAAACTCGAGTTTGTTGCGTATTTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008713
NOS3 MISSION shRNA Lentiviral Transduction Particles
nitric oxide synthase 3 (endothelial cell)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422907    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008713.4-3893s21c1
Sequence:CCGGCTGGAGTATCTTACGTTTAAACTCGAGTTTAAACGTAAGATACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-760s21c1
Sequence:CCGGGATACGCTATGCGGGCTATAGCTCGAGCTATAGCCCGCATAGCGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-402s21c1
Sequence:CCGGACTTCATCAATCAGTACTATACTCGAGTATAGTACTGATTGATGAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008713.4-1398s21c1
Sequence:CCGGATCAAGAGATGGTCAACTATTCTCGAGAATAGTTGACCATCTCTTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008713.2-3844s1c1
Sequence:CCGGGCCCTCTTCATATGCTTTGATCTCGAGATCAAAGCATATGAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-1126s1c1
Sequence:CCGGCCTCACCGCTACAACATACTTCTCGAGAAGTATGTTGTAGCGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-2715s1c1
Sequence:CCGGCTACGAAGAATGGAAGTGGTTCTCGAGAACCACTTCCATTCTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-324s1c1
Sequence:CCGGCCTGGTGTTTCCAAGGAAGTTCTCGAGAACTTCCTTGGAAACACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008713.2-657s1c1
Sequence:CCGGCCACATTAAATACGCAACAAACTCGAGTTTGTTGCGTATTTAATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks