EMAIL THIS PAGE TO A FRIEND

NOX1

NADPH oxidase 1

Synonyms: GP91-2 MOX1 NOH-1 NOH1
UniProtKB ID: Q9Y5S8, A8K836, O95691, Q2PP02
Gene ID:
Human(27035) Summary: This gene encodes a member of the NADPH oxidase family of enzymes responsible for the catalytic one-electron transfer of oxygen to generate superoxide or hydrogen peroxide. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
Mouse(237038) NADPH oxidase 1
Rat(114243) NADPH oxidase 1
Zebrafish(555604) NADPH oxidase 1
chicken(422257) NADPH oxidase 1
domestic cat(101086376) NADPH oxidase 1
Horse(100146916) NADPH oxidase 1
cow(521681) NADPH oxidase 1
dog(492016) NADPH oxidase 1
sheep(100034667) NADPH oxidase 1
naked mole-rat(101718925) NADPH oxidase 1
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007052 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU076051 MISSION® esiRNA esiRNA human NOX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007052 Rosetta Predictions human pricing
NM_013954 Rosetta Predictions human pricing
NM_013955 Rosetta Predictions human pricing
NM_053683 Rosetta Predictions rat pricing
NM_172203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342845 predicted 555
2 SASI_Hs02_00342846 predicted 244
3 SASI_Hs02_00342847 predicted 1981
4 SASI_Hs02_00342848 predicted 562
5 SASI_Hs02_00342849 predicted 208
6 SASI_Hs02_00342850 predicted 859
7 SASI_Hs02_00342851 predicted 916
8 SASI_Hs02_00342852 predicted 1026
9 SASI_Hs02_00342853 predicted 731
10 SASI_Hs02_00342854 predicted 542
11 SASI_Hs01_00077898 predicted 371
12 SASI_Hs01_00077899 predicted 368
13 SASI_Hs01_00077900 predicted 378
14 SASI_Hs01_00077901 predicted 402
15 SASI_Hs01_00077902 predicted 367
16 SASI_Hs01_00077903 predicted 366
17 SASI_Hs01_00077904 predicted 414
18 SASI_Hs01_00077905 predicted 367
19 SASI_Hs01_00077906 predicted 417
20 SASI_Hs01_00077907 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238876 predicted 233
2 SASI_Hs01_00238877 predicted 230
3 SASI_Hs01_00238878 predicted 233
4 SASI_Hs01_00238879 predicted 263
5 SASI_Hs01_00238880 predicted 236
6 SASI_Hs01_00238881 predicted 233
7 SASI_Hs01_00238882 predicted 270
8 SASI_Hs01_00238883 predicted 230
9 SASI_Hs01_00238884 predicted 279
10 SASI_Hs01_00238885 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344894 predicted 555
2 SASI_Hs02_00344895 predicted 245
3 SASI_Hs02_00344896 predicted 1832
4 SASI_Hs02_00344897 predicted 569
5 SASI_Hs02_00344898 predicted 204
6 SASI_Hs02_00344899 predicted 855
7 SASI_Hs02_00344900 predicted 909
8 SASI_Hs02_00344901 predicted 1027
9 SASI_Hs02_00344902 predicted 737
10 SASI_Hs02_00344903 predicted 542
11 SASI_Hs01_00116745 predicted 239
12 SASI_Hs01_00116746 predicted 232
13 SASI_Hs01_00116747 predicted 238
14 SASI_Hs01_00116748 predicted 259
15 SASI_Hs01_00116749 predicted 236
16 SASI_Hs01_00116750 predicted 229
17 SASI_Hs01_00116751 predicted 269
18 SASI_Hs01_00116752 predicted 235
19 SASI_Hs01_00116753 predicted 275
20 SASI_Hs01_00116754 predicted 269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266425 predicted 620
2 SASI_Rn02_00266426 predicted 731
3 SASI_Rn01_00120035 predicted 436
4 SASI_Rn01_00120036 predicted 327
5 SASI_Rn01_00120037 predicted 1863
6 SASI_Rn01_00120038 predicted 1487
7 SASI_Rn01_00120040 predicted 1082
8 SASI_Rn01_00120041 predicted 341
9 SASI_Rn01_00120042 predicted 469
10 SASI_Rn01_00120043 predicted 1457
11 SASI_Rn01_00120039 predicted 705
12 SASI_Rn01_00120044 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025342 predicted 323
2 SASI_Mm01_00025343 predicted 487
3 SASI_Mm01_00025344 predicted 198
4 SASI_Mm01_00025346 predicted 196
5 SASI_Mm01_00025347 predicted 194
6 SASI_Mm01_00025348 predicted 715
7 SASI_Mm01_00025349 predicted 480
8 SASI_Mm01_00025350 predicted 333
9 SASI_Mm01_00025351 predicted 566
10 SASI_Mm02_00343716 predicted 305
11 SASI_Mm01_00025345 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007052
NOX1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-788s21c1
Sequence:CCGGGTTCATCCGGAGGAGTTATTTCTCGAGAAATAACTCCTCCGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-1828s21c1
Sequence:CCGGGCAAATGCTGTCACCGATATTCTCGAGAATATCGGTGACAGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1099s1c1
Sequence:CCGGCCAAGGTTGTTATGCACCCATCTCGAGATGGGTGCATAACAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-563s1c1
Sequence:CCGGCCTGTTTAACTTTGACTGCTACTCGAGTAGCAGTCAAAGTTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-519s1c1
Sequence:CCGGGCCTATATGATCTGCCTACATCTCGAGATGTAGGCAGATCATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-467s1c1
Sequence:CCGGCCGCACACTGAGAAAGCAATTCTCGAGAATTGCTTTCTCAGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1572s1c1
Sequence:CCGGGAACAGGAGATGGAGGAATTACTCGAGTAATTCCTCCATCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007052
NOX1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-788s21c1
Sequence:CCGGGTTCATCCGGAGGAGTTATTTCTCGAGAAATAACTCCTCCGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-1828s21c1
Sequence:CCGGGCAAATGCTGTCACCGATATTCTCGAGAATATCGGTGACAGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1099s1c1
Sequence:CCGGCCAAGGTTGTTATGCACCCATCTCGAGATGGGTGCATAACAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-563s1c1
Sequence:CCGGCCTGTTTAACTTTGACTGCTACTCGAGTAGCAGTCAAAGTTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-519s1c1
Sequence:CCGGGCCTATATGATCTGCCTACATCTCGAGATGTAGGCAGATCATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-467s1c1
Sequence:CCGGCCGCACACTGAGAAAGCAATTCTCGAGAATTGCTTTCTCAGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1572s1c1
Sequence:CCGGGAACAGGAGATGGAGGAATTACTCGAGTAATTCCTCCATCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007052
NOX1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428100    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-788s21c1
Sequence:CCGGGTTCATCCGGAGGAGTTATTTCTCGAGAAATAACTCCTCCGGATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007052.4-1828s21c1
Sequence:CCGGGCAAATGCTGTCACCGATATTCTCGAGAATATCGGTGACAGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1099s1c1
Sequence:CCGGCCAAGGTTGTTATGCACCCATCTCGAGATGGGTGCATAACAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-563s1c1
Sequence:CCGGCCTGTTTAACTTTGACTGCTACTCGAGTAGCAGTCAAAGTTAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-519s1c1
Sequence:CCGGGCCTATATGATCTGCCTACATCTCGAGATGTAGGCAGATCATATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-467s1c1
Sequence:CCGGCCGCACACTGAGAAAGCAATTCTCGAGAATTGCTTTCTCAGTGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007052.3-1572s1c1
Sequence:CCGGGAACAGGAGATGGAGGAATTACTCGAGTAATTCCTCCATCTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172203
NOX1 MISSION shRNA Bacterial Glycerol Stock
NADPH oxidase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000222685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1236s1c2
Sequence:CCGGCTTGAAATCTATCTGGTACAACTCGAGTTGTACCAGATAGATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1429s1c2
Sequence:CCGGGATAGCAACATTGCTGGTCATCTCGAGATGACCAGCAATGTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-950s1c1
Sequence:CCGGGCATGGAAGTAGGACAGTATACTCGAGTATACTGTCCTACTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-882s1c1
Sequence:CCGGCGTGATTACCAAGGTTGTCATCTCGAGATGACAACCTTGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-444s1c1
Sequence:CCGGGAAAGAAGATTCTTGGCTAAACTCGAGTTTAGCCAAGAATCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172203
NOX1 MISSION shRNA shRNA Plasmid DNA
NADPH oxidase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000222685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1236s1c2
Sequence:CCGGCTTGAAATCTATCTGGTACAACTCGAGTTGTACCAGATAGATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1429s1c2
Sequence:CCGGGATAGCAACATTGCTGGTCATCTCGAGATGACCAGCAATGTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-950s1c1
Sequence:CCGGGCATGGAAGTAGGACAGTATACTCGAGTATACTGTCCTACTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-882s1c1
Sequence:CCGGCGTGATTACCAAGGTTGTCATCTCGAGATGACAACCTTGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-444s1c1
Sequence:CCGGGAAAGAAGATTCTTGGCTAAACTCGAGTTTAGCCAAGAATCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172203
NOX1 MISSION shRNA Lentiviral Transduction Particles
NADPH oxidase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000222685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1236s1c2
Sequence:CCGGCTTGAAATCTATCTGGTACAACTCGAGTTGTACCAGATAGATTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-1429s1c2
Sequence:CCGGGATAGCAACATTGCTGGTCATCTCGAGATGACCAGCAATGTTGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-950s1c1
Sequence:CCGGGCATGGAAGTAGGACAGTATACTCGAGTATACTGTCCTACTTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-882s1c1
Sequence:CCGGCGTGATTACCAAGGTTGTCATCTCGAGATGACAACCTTGGTAATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172203.1-444s1c1
Sequence:CCGGGAAAGAAGATTCTTGGCTAAACTCGAGTTTAGCCAAGAATCTTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks