EMAIL THIS PAGE TO A FRIEND

NPAS1

neuronal PAS domain protein 1

Synonyms: MOP5 PASD5 bHLHe11
UniProtKB ID: Q99742, Q99632, Q9BY83
Gene ID:
Human(4861) Summary: The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH)-PAS family of transcription factors. Studies of a related mouse gene suggest that it functions in neurons. The exact function of this gene is unclear, but it may play protective or modulatory roles during late embryogenesis and postnatal development. [provided by RefSeq, Jul 2008]
Mouse(18142) neuronal PAS domain protein 1
Rat(308387) neuronal PAS domain protein 1
domestic guinea pig(100727092) neuronal PAS domain protein 1
naked mole-rat(101719003) neuronal PAS domain protein 1
sheep(101117609) neuronal PAS domain protein 1
domestic cat(101099343) neuronal PAS domain protein 1
Horse(100071200) neuronal PAS domain protein 1
cow(528272) neuronal PAS domain protein 1
dog(484424) neuronal PAS domain protein 1
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002517 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002517 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002517 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002517 Rosetta Predictions human pricing
NM_001107479 Rosetta Predictions rat pricing
NM_008718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135814 predicted 1106
2 SASI_Hs01_00135815 predicted 1239
3 SASI_Hs01_00135816 predicted 232
4 SASI_Hs01_00135817 predicted 1281
5 SASI_Hs01_00135818 predicted 1049
6 SASI_Hs02_00333981 predicted 1338
7 SASI_Hs01_00135819 predicted 351
8 SASI_Hs01_00135820 predicted 1189
9 SASI_Hs01_00135821 predicted 1574
10 SASI_Hs01_00135822 predicted 1538
11 SASI_Hs01_00135823 predicted 1633
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107479 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229235 predicted 1092
2 SASI_Rn02_00229236 predicted 538
3 SASI_Rn02_00229237 predicted 1450
4 SASI_Rn02_00229238 predicted 323
5 SASI_Rn02_00229239 predicted 1406
6 SASI_Rn02_00229240 predicted 1273
7 SASI_Rn02_00229241 predicted 1476
8 SASI_Rn02_00229242 predicted 1191
9 SASI_Rn02_00229243 predicted 1067
10 SASI_Rn02_00229244 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117347 predicted 957
2 SASI_Mm01_00117349 predicted 810
3 SASI_Mm01_00117350 predicted 1439
4 SASI_Mm01_00117351 predicted 1258
5 SASI_Mm01_00117352 predicted 1071
6 SASI_Mm01_00117353 predicted 1021
7 SASI_Mm02_00314556 predicted 1492
8 SASI_Mm01_00117354 predicted 1182
9 SASI_Mm01_00117355 predicted 1706
10 SASI_Mm01_00117356 predicted 333
11 SASI_Mm01_00117348 predicted 1312
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008718
NPAS1 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-963s1c1
Sequence:CCGGGCACGGACACATGATTGTCTTCTCGAGAAGACAATCATGTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1020s1c1
Sequence:CCGGGAGCAGAGTTAGCGACCATATCTCGAGATATGGTCGCTAACTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-508s1c1
Sequence:CCGGGTGTTCGCTTTGAACCAGGAACTCGAGTTCCTGGTTCAAAGCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1280s1c1
Sequence:CCGGGCAATGCTGAAGGTAGTCAAACTCGAGTTTGACTACCTTCAGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-321s1c1
Sequence:CCGGCGTGCGTCTTAGCGTCACCTACTCGAGTAGGTGACGCTAAGACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008718
NPAS1 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-963s1c1
Sequence:CCGGGCACGGACACATGATTGTCTTCTCGAGAAGACAATCATGTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1020s1c1
Sequence:CCGGGAGCAGAGTTAGCGACCATATCTCGAGATATGGTCGCTAACTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-508s1c1
Sequence:CCGGGTGTTCGCTTTGAACCAGGAACTCGAGTTCCTGGTTCAAAGCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1280s1c1
Sequence:CCGGGCAATGCTGAAGGTAGTCAAACTCGAGTTTGACTACCTTCAGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-321s1c1
Sequence:CCGGCGTGCGTCTTAGCGTCACCTACTCGAGTAGGTGACGCTAAGACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008718
NPAS1 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-963s1c1
Sequence:CCGGGCACGGACACATGATTGTCTTCTCGAGAAGACAATCATGTGTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1020s1c1
Sequence:CCGGGAGCAGAGTTAGCGACCATATCTCGAGATATGGTCGCTAACTCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-508s1c1
Sequence:CCGGGTGTTCGCTTTGAACCAGGAACTCGAGTTCCTGGTTCAAAGCGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-1280s1c1
Sequence:CCGGGCAATGCTGAAGGTAGTCAAACTCGAGTTTGACTACCTTCAGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008718.1-321s1c1
Sequence:CCGGCGTGCGTCTTAGCGTCACCTACTCGAGTAGGTGACGCTAAGACGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002517
NPAS1 MISSION shRNA Bacterial Glycerol Stock
neuronal PAS domain protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1395s1c1
Sequence:CCGGCCAAACTCCTTTGGATGCCTTCTCGAGAAGGCATCCAAAGGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-603s1c1
Sequence:CCGGTGGCTTTGTGTTCGCCTTGAACTCGAGTTCAAGGCGAACACAAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-899s1c1
Sequence:CCGGCCTTCTTTGTCCGCATGAAATCTCGAGATTTCATGCGGACAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1062s1c1
Sequence:CCGGCCATGGACACATGATCGTCTTCTCGAGAAGACGATCATGTGTCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1635s1c1
Sequence:CCGGGCCCGAGTTCACCTCTGTCATCTCGAGATGACAGAGGTGAACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002517
NPAS1 MISSION shRNA shRNA Plasmid DNA
neuronal PAS domain protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1395s1c1
Sequence:CCGGCCAAACTCCTTTGGATGCCTTCTCGAGAAGGCATCCAAAGGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-603s1c1
Sequence:CCGGTGGCTTTGTGTTCGCCTTGAACTCGAGTTCAAGGCGAACACAAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-899s1c1
Sequence:CCGGCCTTCTTTGTCCGCATGAAATCTCGAGATTTCATGCGGACAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1062s1c1
Sequence:CCGGCCATGGACACATGATCGTCTTCTCGAGAAGACGATCATGTGTCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1635s1c1
Sequence:CCGGGCCCGAGTTCACCTCTGTCATCTCGAGATGACAGAGGTGAACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002517
NPAS1 MISSION shRNA Lentiviral Transduction Particles
neuronal PAS domain protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1395s1c1
Sequence:CCGGCCAAACTCCTTTGGATGCCTTCTCGAGAAGGCATCCAAAGGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-603s1c1
Sequence:CCGGTGGCTTTGTGTTCGCCTTGAACTCGAGTTCAAGGCGAACACAAAGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-899s1c1
Sequence:CCGGCCTTCTTTGTCCGCATGAAATCTCGAGATTTCATGCGGACAAAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1062s1c1
Sequence:CCGGCCATGGACACATGATCGTCTTCTCGAGAAGACGATCATGTGTCCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002517.2-1635s1c1
Sequence:CCGGGCCCGAGTTCACCTCTGTCATCTCGAGATGACAGAGGTGAACTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks