EMAIL THIS PAGE TO A FRIEND

NPC1

Niemann-Pick disease, type C1

Synonyms: NPC
UniProtKB ID: O15118, Q9P130
Gene ID:
Human(4864) Summary: This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
Mouse(18145) Niemann Pick type C1
Rat(266732) Niemann-Pick disease, type C1
naked mole-rat(101710344) Niemann-Pick disease, type C1
Domestic Rabbit(100008746) Niemann-Pick disease, type C1
domestic guinea pig(100718604) Niemann-Pick disease, type C1
Thale Cress(837234) non-specific phospholipase C1
Zebrafish(553330) Niemann-Pick disease, type C1
chicken(421076) Niemann-Pick disease, type C1
cow(286772) Niemann-Pick disease, type C1
Horse(100059175) Niemann-Pick disease, type C1
domestic cat(493693) Niemann-Pick disease, type C1
dog(403698) Niemann-Pick disease, type C1
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000271 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000271 Rosetta Predictions human pricing
NM_008720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101265 predicted 2016
2 SASI_Hs01_00101266 predicted 1981
3 SASI_Hs01_00101267 predicted 3303
4 SASI_Hs01_00101268 predicted 2187
5 SASI_Hs01_00101269 predicted 1535
6 SASI_Hs02_00302226 predicted 3904
7 SASI_Hs01_00101270 predicted 349
8 SASI_Hs01_00101272 predicted 2727
9 SASI_Hs02_00302227 predicted 1777
10 SASI_Hs01_00101274 predicted 547
11 SASI_Hs01_00101271 predicted 3941
12 SASI_Hs01_00101273 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075301 predicted 3240
2 SASI_Mm01_00075303 predicted 2652
3 SASI_Mm01_00075304 predicted 3743
4 SASI_Mm01_00075305 predicted 3272
5 SASI_Mm01_00075306 predicted 3378
6 SASI_Mm02_00314558 predicted 1676
7 SASI_Mm01_00075307 predicted 4004
8 SASI_Mm01_00075308 predicted 3321
9 SASI_Mm02_00314559 predicted 1582
10 SASI_Mm01_00075309 predicted 315
11 SASI_Mm01_00075302 predicted 2757
12 SASI_Mm01_00075310 predicted 2767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000271
NPC1 MISSION shRNA Bacterial Glycerol Stock
Niemann-Pick disease, type C1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-2880s21c1
Sequence:CCGGACTCCTACATGGTGGATTATTCTCGAGAATAATCCACCATGTAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-387s21c1
Sequence:CCGGAGAGGTACAATTGCGAATATTCTCGAGAATATTCGCAATTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-3094s21c1
Sequence:CCGGGTCCTGGATCGACGATTATTTCTCGAGAAATAATCGTCGATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000271.1-4323s1c1
Sequence:CCGGCCACAAGTTCTATACCATATTCTCGAGAATATGGTATAGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-1685s1c1
Sequence:CCGGCCTCTCTGAATGATACAAGTTCTCGAGAACTTGTATCATTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3856s1c1
Sequence:CCGGCCTGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3295s1c1
Sequence:CCGGGCCCGACTTATAGCCAGTAATCTCGAGATTACTGGCTATAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-517s1c1
Sequence:CCGGCCTGTTACAAACCAGACGAAACTCGAGTTTCGTCTGGTTTGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000271
NPC1 MISSION shRNA shRNA Plasmid DNA
Niemann-Pick disease, type C1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-2880s21c1
Sequence:CCGGACTCCTACATGGTGGATTATTCTCGAGAATAATCCACCATGTAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-387s21c1
Sequence:CCGGAGAGGTACAATTGCGAATATTCTCGAGAATATTCGCAATTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-3094s21c1
Sequence:CCGGGTCCTGGATCGACGATTATTTCTCGAGAAATAATCGTCGATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000271.1-4323s1c1
Sequence:CCGGCCACAAGTTCTATACCATATTCTCGAGAATATGGTATAGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-1685s1c1
Sequence:CCGGCCTCTCTGAATGATACAAGTTCTCGAGAACTTGTATCATTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3856s1c1
Sequence:CCGGCCTGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3295s1c1
Sequence:CCGGGCCCGACTTATAGCCAGTAATCTCGAGATTACTGGCTATAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-517s1c1
Sequence:CCGGCCTGTTACAAACCAGACGAAACTCGAGTTTCGTCTGGTTTGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000271
NPC1 MISSION shRNA Lentiviral Transduction Particles
Niemann-Pick disease, type C1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-2880s21c1
Sequence:CCGGACTCCTACATGGTGGATTATTCTCGAGAATAATCCACCATGTAGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-387s21c1
Sequence:CCGGAGAGGTACAATTGCGAATATTCTCGAGAATATTCGCAATTGTACCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000271.4-3094s21c1
Sequence:CCGGGTCCTGGATCGACGATTATTTCTCGAGAAATAATCGTCGATCCAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000271.1-4323s1c1
Sequence:CCGGCCACAAGTTCTATACCATATTCTCGAGAATATGGTATAGAACTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-1685s1c1
Sequence:CCGGCCTCTCTGAATGATACAAGTTCTCGAGAACTTGTATCATTCAGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3856s1c1
Sequence:CCGGCCTGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-3295s1c1
Sequence:CCGGGCCCGACTTATAGCCAGTAATCTCGAGATTACTGGCTATAAGTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000271.1-517s1c1
Sequence:CCGGCCTGTTACAAACCAGACGAAACTCGAGTTTCGTCTGGTTTGTAACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008720
NPC1 MISSION shRNA Bacterial Glycerol Stock
Niemann-Pick disease, type C1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-1822s1c1
Sequence:CCGGCCCGTGAATAATTACTACAATCTCGAGATTGTAGTAATTATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-2724s1c1
Sequence:CCGGGCCAAACGATTCGTATGTGATCTCGAGATCACATACGAATCGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008720.1-4121s1c1
Sequence:CCGGGCAGTATTAATGGATCTGAAACTCGAGTTTCAGATCCATTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-3856s1c1
Sequence:CCGGCCCGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-781s1c1
Sequence:CCGGCCCATGAGAAATGCCACCAAACTCGAGTTTGGTGGCATTTCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008720
NPC1 MISSION shRNA shRNA Plasmid DNA
Niemann-Pick disease, type C1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-1822s1c1
Sequence:CCGGCCCGTGAATAATTACTACAATCTCGAGATTGTAGTAATTATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-2724s1c1
Sequence:CCGGGCCAAACGATTCGTATGTGATCTCGAGATCACATACGAATCGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008720.1-4121s1c1
Sequence:CCGGGCAGTATTAATGGATCTGAAACTCGAGTTTCAGATCCATTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-3856s1c1
Sequence:CCGGCCCGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-781s1c1
Sequence:CCGGCCCATGAGAAATGCCACCAAACTCGAGTTTGGTGGCATTTCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008720
NPC1 MISSION shRNA Lentiviral Transduction Particles
Niemann-Pick disease, type C1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-1822s1c1
Sequence:CCGGCCCGTGAATAATTACTACAATCTCGAGATTGTAGTAATTATTCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-2724s1c1
Sequence:CCGGGCCAAACGATTCGTATGTGATCTCGAGATCACATACGAATCGTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012123    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008720.1-4121s1c1
Sequence:CCGGGCAGTATTAATGGATCTGAAACTCGAGTTTCAGATCCATTAATACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-3856s1c1
Sequence:CCGGCCCGTCTTACTCAGTTACATACTCGAGTATGTAACTGAGTAAGACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008720.1-781s1c1
Sequence:CCGGCCCATGAGAAATGCCACCAAACTCGAGTTTGGTGGCATTTCTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks