EMAIL THIS PAGE TO A FRIEND

NPFFR2

neuropeptide FF receptor 2

Synonyms: GPR74 HLWAR77 NPFF2 NPGPR
UniProtKB ID: Q9Y5X5, Q96RV1, Q9NR49
Gene ID:
Human(10886) Summary: This gene encodes a member of a subfamily of G-protein-coupled neuropeptide receptors. This protein is activated by the neuropeptides A-18-amide (NPAF) and F-8-amide (NPFF) and may function in pain modulation and regulation of the opioid system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
Mouse(104443) neuropeptide FF receptor 2
Rat(78964) neuropeptide FF receptor 2
chicken(428759) neuropeptide FF receptor 2
cow(530560) neuropeptide FF receptor 2
Horse(100050041) neuropeptide FF receptor 2
dog(100686684) neuropeptide FF receptor 2
domestic cat(101083003) neuropeptide FF receptor 2
sheep(101102486) neuropeptide FF receptor 2
Domestic Rabbit(100347167) neuropeptide FF receptor 2
naked mole-rat(101725161) neuropeptide FF receptor 2
domestic guinea pig(100729252) neuropeptide FF receptor 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004885 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004885 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004885 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133192 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133192 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133192 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158261 MISSION® esiRNA esiRNA human NPFFR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004885 Rosetta Predictions human pricing
NM_053036 Rosetta Predictions human pricing
NM_023980 Rosetta Predictions rat pricing
NM_133192 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004885 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055502 predicted 698
2 SASI_Hs01_00055503 predicted 694
3 SASI_Hs01_00055504 predicted 682
4 SASI_Hs01_00055506 predicted 763
5 SASI_Hs01_00055507 predicted 764
6 SASI_Hs01_00055508 predicted 624
7 SASI_Hs01_00055509 predicted 635
8 SASI_Hs02_00338518 predicted 979
9 SASI_Hs01_00055510 predicted 754
10 SASI_Hs01_00055511 predicted 900
11 SASI_Hs01_00055505 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123952 predicted 345
2 SASI_Hs01_00123953 predicted 341
3 SASI_Hs01_00123954 predicted 325
4 SASI_Hs01_00123956 predicted 404
5 SASI_Hs01_00123957 predicted 408
6 SASI_Hs01_00123958 predicted 269
7 SASI_Hs01_00123959 predicted 282
8 SASI_Hs02_00361859 predicted 613
9 SASI_Hs01_00123960 predicted 404
10 SASI_Hs01_00123961 predicted 542
11 SASI_Hs01_00123955 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055038 predicted 226
2 SASI_Rn02_00263803 predicted 980
3 SASI_Rn01_00055039 predicted 534
4 SASI_Rn01_00055040 predicted 280
5 SASI_Rn01_00055041 predicted 471
6 SASI_Rn01_00055042 predicted 266
7 SASI_Rn01_00055043 predicted 642
8 SASI_Rn01_00055044 predicted 460
9 SASI_Rn01_00055045 predicted 637
10 SASI_Rn01_00055046 predicted 899
11 SASI_Rn01_00055047 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133192 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086381 predicted 1190
2 SASI_Mm01_00086382 predicted 344
3 SASI_Mm01_00086383 predicted 630
4 SASI_Mm01_00086384 predicted 356
5 SASI_Mm01_00086385 predicted 749
6 SASI_Mm01_00086386 predicted 751
7 SASI_Mm01_00086387 predicted 344
8 SASI_Mm01_00086388 predicted 1099
9 SASI_Mm01_00086389 predicted 780
10 SASI_Mm01_00086390 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004885
NPFFR2 MISSION shRNA Bacterial Glycerol Stock
neuropeptide FF receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-909s21c1
Sequence:CCGGGTCCTAGCCATCACCATTATGCTCGAGCATAATGGTGATGGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-689s21c1
Sequence:CCGGCATATTCTGCATGCCTATAACCTCGAGGTTATAGGCATGCAGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004885.2-1688s21c1
Sequence:CCGGCTAACTCTACTACGCATTATACTCGAGTATAATGCGTAGTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004885.1-1687s1c1
Sequence:CCGGCCTAACTCTACTACGCATTATCTCGAGATAATGCGTAGTAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-390s1c1
Sequence:CCGGCGGGAGAGGTTCATCATGAATCTCGAGATTCATGATGAACCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-866s1c1
Sequence:CCGGGCTCACTATCAAGACAGCGTTCTCGAGAACGCTGTCTTGATAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-702s1c1
Sequence:CCGGCCTATAACACTGCTGGACAATCTCGAGATTGTCCAGCAGTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-1427s1c1
Sequence:CCGGCCGTGGTTTCCAAGAAGCTTTCTCGAGAAAGCTTCTTGGAAACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004885
NPFFR2 MISSION shRNA shRNA Plasmid DNA
neuropeptide FF receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-909s21c1
Sequence:CCGGGTCCTAGCCATCACCATTATGCTCGAGCATAATGGTGATGGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-689s21c1
Sequence:CCGGCATATTCTGCATGCCTATAACCTCGAGGTTATAGGCATGCAGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004885.2-1688s21c1
Sequence:CCGGCTAACTCTACTACGCATTATACTCGAGTATAATGCGTAGTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004885.1-1687s1c1
Sequence:CCGGCCTAACTCTACTACGCATTATCTCGAGATAATGCGTAGTAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-390s1c1
Sequence:CCGGCGGGAGAGGTTCATCATGAATCTCGAGATTCATGATGAACCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-866s1c1
Sequence:CCGGGCTCACTATCAAGACAGCGTTCTCGAGAACGCTGTCTTGATAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-702s1c1
Sequence:CCGGCCTATAACACTGCTGGACAATCTCGAGATTGTCCAGCAGTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-1427s1c1
Sequence:CCGGCCGTGGTTTCCAAGAAGCTTTCTCGAGAAAGCTTCTTGGAAACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004885
NPFFR2 MISSION shRNA Lentiviral Transduction Particles
neuropeptide FF receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-909s21c1
Sequence:CCGGGTCCTAGCCATCACCATTATGCTCGAGCATAATGGTGATGGCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004885.2-689s21c1
Sequence:CCGGCATATTCTGCATGCCTATAACCTCGAGGTTATAGGCATGCAGAATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357270    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004885.2-1688s21c1
Sequence:CCGGCTAACTCTACTACGCATTATACTCGAGTATAATGCGTAGTAGAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008916    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004885.1-1687s1c1
Sequence:CCGGCCTAACTCTACTACGCATTATCTCGAGATAATGCGTAGTAGAGTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-390s1c1
Sequence:CCGGCGGGAGAGGTTCATCATGAATCTCGAGATTCATGATGAACCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-866s1c1
Sequence:CCGGGCTCACTATCAAGACAGCGTTCTCGAGAACGCTGTCTTGATAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-702s1c1
Sequence:CCGGCCTATAACACTGCTGGACAATCTCGAGATTGTCCAGCAGTGTTATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004885.1-1427s1c1
Sequence:CCGGCCGTGGTTTCCAAGAAGCTTTCTCGAGAAAGCTTCTTGGAAACCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133192
NPFFR2 MISSION shRNA Bacterial Glycerol Stock
neuropeptide FF receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-185s1c1
Sequence:CCGGGCATCACTGGTATTCAGATATCTCGAGATATCTGAATACCAGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1034s1c1
Sequence:CCGGGCGTATCATCAACATCTACATCTCGAGATGTAGATGTTGATGATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-645s1c1
Sequence:CCGGCCATCTGCAATAATGTTACATCTCGAGATGTAACATTATTGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1206s1c1
Sequence:CCGGGCGAAACGCAACATAGTCATACTCGAGTATGACTATGTTGCGTTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-413s1c1
Sequence:CCGGGCCTATCACATTGCTGGACAACTCGAGTTGTCCAGCAATGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133192
NPFFR2 MISSION shRNA shRNA Plasmid DNA
neuropeptide FF receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-185s1c1
Sequence:CCGGGCATCACTGGTATTCAGATATCTCGAGATATCTGAATACCAGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1034s1c1
Sequence:CCGGGCGTATCATCAACATCTACATCTCGAGATGTAGATGTTGATGATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-645s1c1
Sequence:CCGGCCATCTGCAATAATGTTACATCTCGAGATGTAACATTATTGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1206s1c1
Sequence:CCGGGCGAAACGCAACATAGTCATACTCGAGTATGACTATGTTGCGTTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-413s1c1
Sequence:CCGGGCCTATCACATTGCTGGACAACTCGAGTTGTCCAGCAATGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133192
NPFFR2 MISSION shRNA Lentiviral Transduction Particles
neuropeptide FF receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-185s1c1
Sequence:CCGGGCATCACTGGTATTCAGATATCTCGAGATATCTGAATACCAGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1034s1c1
Sequence:CCGGGCGTATCATCAACATCTACATCTCGAGATGTAGATGTTGATGATACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-645s1c1
Sequence:CCGGCCATCTGCAATAATGTTACATCTCGAGATGTAACATTATTGCAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-1206s1c1
Sequence:CCGGGCGAAACGCAACATAGTCATACTCGAGTATGACTATGTTGCGTTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133192.2-413s1c1
Sequence:CCGGGCCTATCACATTGCTGGACAACTCGAGTTGTCCAGCAATGTGATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks